Description :
From Genome Similarity Track
Location :
Scaffold_90:21- 1306
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_90-snap-gene-0.10Novel protein

Sequence
1285 bases(100 bases per row)
GTTGCCACGACTGTCACTCCAGTTGCCACCACCGCAGCTCCAGTCGCCACCATCGCTACTCCAGTGGCCACGACCGTCGCCCCAGTAGCCACGACTGCCA
CCCCAGTCGCTACGACCTCTGCCCCAGCCGCTGCCGTGACGACCAGCCCGGCGATCGTTGCGACCCTCGCTCCAGCGACGAACCCGTCCATGGGCAAGCA
GCTCCCTGGCAAGAAGACCAACTGCATGATCAACAAGAAGCCGGCCACCGCGGCCACGGCCTCCAAGAGCGCGGCTACTGCTCCTGCGACGGCCACCAAG
AGCAACGAGGATATGAAGCAGTCGTACAGCGAGTACAAGGAGCTGAGCGACTCGGAGGAGACCGAGGAGACGGGCAACGAGTACGACGCCGACGAGCATG
AGGAGGATGAGGAGACGACGTACAGCGAGTAAGTCAACTGGCTGCTTCCAGTCTAGAGGCCTGCGTCGTCTTTGTAAACTGCCGCCGACGGGAGTCGAAG
AGCGACGGCGACTGTGGACCTATTTAACTGTCTCGGCCCGCCTTCACCGTTCGCCCACCGCAAGACCGTCCGTCCATCTCTCAAGAAGCTTGCTCGCGGT
GGTGGGAGTCCGTTCTTTTTGCTGCATGTCAACTTGTCTTTCTTTGCGTCCCGAGTCCTACCGAAAAGCTCAATACAACAAACGTCCCCACTGGGTTGTC
AATATACTCACTGTAGCTGTGTGCTTGATGGTTGGTCCAAGGCACGCTCGACTGGTGATGTCCATCACTGGTGGATCTATTCACCGAAAAATGTAGCCAT
AATCGAACAGCTACCCCACATTTGTGACATGTGGCTGAAGCGAGTTGATAGTGACAGGGACGCGTCCTTTCGCGCACGCGCTCGCTTCAATCACCACCAC
GCGTGACAAGTTCTGGTCTCTGAGAGCGAGAAGGAGGGATGCCGATCGACGTGACGGCACGCCACGCGTTCGCGTACAGTGGGCGGCCGCTGCAGCTCGC
GGACGAGCACACGATGGCGTTCGTGAGCGGCAACGCGCTCGCGTTCACATCCACGGTCTCCCACTCGCAGCACTTCCTGCTGCGCTCCAAGCCGCGATCT
CTCGTGGCCTTTGACTGCAACTGGCGCACGGCGACCGTGGCCATGACGGCGCGCGAGCCGAGTCCCGACATCCTGCTCTACTCGTATCCGGACAAGAAGC
TGCGTGGCAAGCTGCAGCACGGCGCGCGCTTCGAGTACTCCAAGCTCACCTTCTCGCGCTGCGGCCGGCGACTCGTGAGTCTGCG