Description :
From Genome Similarity Track
Location :
Scaffold_425:20999- 23168
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_425-fgenesh-gene-0.7Protein kinase

Sequence
2169 bases(100 bases per row)
CACTACTCAATAGAAACACACTCATAACTATCCCTCACATCTCTTTTGCTTTTCACTTCCTCAACTCTCGAGGTCTTCAGGCTCAAAAGCTGTACGTCTT
GACGCCAACGTTGGCGATCGGTACTTTCGCGAGCACGACCATGGCTTCGCTGGCGCTGGGGCGTTTCTGTGGGTCCAGGTCCAGACACGCGTCAATTAGC
TCCGCAATCTCCAGCGGACAGAACAGGGAGGTCGCAGGCTTGAGCTCTCCAGACACTACTTTCTCCAGGATCTCCAGTGGTGGGAGGTCGTTCCCCGTAG
TCATGCACTTGAGCCCTTCGTAGGGCGACTGGTGGGTGTCCAGCTCCGAGAGAAGCACGCCAAACGCAAACATATCCGACTTCTCAGAGTGAGCTTCGCC
CTGGAGCACCTCCGGGGCGGTCCAGTACGACCTCTCCATCACCTGGTTCTCCTCTGAACCAGATGCTGCTGTTACCAGTTCGCTCAGGCGGGATCTGCCA
ACACCCGTGTTGATCAGTTTCGGATCGAGTTCCATTGTGAGCAGCACGTTCTTCGACTTGAGGTCGCGGTGCACCACGCTGGGCTGTTGCTGGTGGTGCA
GATGACAGATCGCGCTCGCAATGCCCATCGCGATACGCATCTTGGCCTTCTCCCACGCGAGCTGCAGACAGTGCTGCGTCAGGTAGAGCTGCAAGTTGCC
ATTGTCGACGTACTCCATGAGCATACACAGGTTCTGGAGCGTCGTCCAGGCGACGCCAATGAACTTCGCGATGTTCGGGTGGTCTAACGCCGCGTTGAGC
GTGATCTCGCCCATAAACTCCTCCAGTTCCTCGTACTCGGCCTTCTTTGCTCGCGAGAGGCGCTTCACGGCCACGTGCGTGCCTCGGACGCTCGCCAACC
AGACTTCGCTGCGAGAACAAGAAGAAGATGAGACTTCCGAGAGGAGGTTGACAAACTGGATCTGGTCGAATGCGACCGTGTTGAGCCGTAGAGACGGGTG
GTTCACGAGCGTGTTGAGTACGTTGTTCGAGCTGAACGCGGCGAAGCTCTCGATCGACGACGACGACGAGATCGCCGAAAGCCGCGCGTCCACCATCACC
ACTGAGTTCCGGTTTAAGAACGAGAAAGGACCGCTTGCGTACGTGCCGTCCGATGTCGACGTGATCGTGTTGCCTCGACAGGCAGTACCGCCATTACTGT
CCGTCTTGAGCTCAAAACGCTTGAATGTCTTGCGCCGAATGTAGATCGCGACGCCTGTGACGCCCAGCGCGACGGAGATCAGGATCGGGATCAGGTACAG
CAGGCTAAACTGCTTCTCTTTGGCCACCTGGCGCAGCCACGACGTTACGAGAGCGCCAGGCTCCGGACGGCACCATTCATCAGTTGTAGGCTTTGCCAAA
CCACTTCCAGTACTTGGCGAATACGGGATGCAGGGAATGACCATCGAGGGCTTGGCGGGGCATTGGCTCAATGAAGAGCTAGCGGAAGTGTCGTCACTGC
TGCTGAGAGCGTGGATGCTGTACATGACGTAATTCTCATTGTCGTTCTCCCACGCGTGCTTTCGGACACTGAGCTCTGGGATTGCAGACTCCTCACCACC
GTCCGCCCACATTGGGGACAGGCGAGAAGACGACGAGTTGCTGGTATCGCTGCTGTTGCTCTGGATACCTCCAGCCACAGCGCACAGGCTCTTGCTCTTG
ATCTGGTCGTCTGAGCACGCCAGAGCCTGATACAAACTCGGTTCACTAGCGTTGCCGCTGGTTGAGCAGTTGTGCACCGTACAGCTGCTGCTACTGATCC
CCATAGAGGTCTCCCTTGAGACGGCAATACCGCTCATCGCGAGCCCGCACTTCACGTACACAGCAGTCAGCGACGATCCGCTCTCATCAAATGCGTAGCC
AGAATCCCACACGAGCGCGCGCTGCAAGAGCGCAGGCAGGTCGTCAAACTGCAATGACGCGTCTGAGAGCCGCTGCTCAATCTCCTTTGGGAGCGAGTCA
TGTAGAATTAGTTTGTCGATAAAGCCACTCGCTCCTCCTTCATTGCTATCGCCAGAAGCCAGGTAGCGTCGATAGAACTGCTGCGTAAAGTCGGACGACG
AGCCGTCGTACTTGTATCCCGCGCTCACATACACGCCGTGCGCGTCCTTCGATGACTCGGACGTGCCGA