Description :
From Genome Similarity Track
Location :
Scaffold_32:209953- 212936
Sequence
2983 bases(100 bases per row)
GCTTGTTGGATCTTGATCCGGACAGCCAAAATGGCCATCGCTGCAAAATCACCTCTCTTAATTCATAGAGTACTGCGGCAAAAAGTGCGTAATCCTCGAT
GAACCGACTGTAGTAGTTCAAACTATCCAAGAAGGATTGCATCGCCCGTAATGACTGTGGGAAGGATAAGTCTGCCAACGAAGACAGGACCTTCGGATTC
GCCTCCAATCCCTCCTTAGAGACTCGATGACTTAAGTAATCCACCTTGTGCATCCCCCAATAGCTCTTCATCACGCTGATAGAGAGATTCCACTTAGTAC
ACGCCTCTAGTAGGGATGTCACTCTTTCGCACAATTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGAGTTAGGATCTGCGTCCTAACACTGATGG
AGTCCCCGGATCCCTGGCTCTCCTGCTTCGAATGGATCCATTTCCGTATGACTTTCCCCGGCTCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCAT
AGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGCGCATTCTTCAATCTAAAGAGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGC
GGATATCGCGCGAGCTCGATCCGTCATAGCCACCACCCAGAAACCACTGGCCATATCTAGAGAACAGTGCCAGCGTACTTTATCCAAATCTTGCAATAGC
TCATTGATTAGAGACATTGGATCCACTATCAGTCGGGTCAGGCCGTTCACTAACCGGTAATTAATACACAGACGTATATCTACTCCGTTCTTCTTAACGA
TGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAACTGATGAATTTGGCTTGCAGTAGCCCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTAAC
GCGCCACCTTTCGCACCATTTGAGCGATCGGGCTTCGCGTCACCGACATCGATGTCACTTTTGACTCCGCGTGCAGCTGGTGGTAATTTACCCCCCTTGC
CAATCAGCAGATGTCGGCTTTCCCAGATCTTCTGGCGTAGCCGATCCACTTCCGCGGGTTCGTTCGCCCTCCGGATCCACTTGGGTATCATCAATCGTGA
CCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATC
TTCGGTCTTTGTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGCGGGATCGGGTATCCTAGTACCTAGG
AAACTACCTCTCGGATCGACTTGATCCTCTGGTGAGTTTACACACGACGGTTCCTGTTTAGCCAGTGTTGCCACTTTCGACGAGGATCCAAGAACTCTGT
CCAATGGAGAGCTTGGATCCAACTGTGGGTCAGCAGGATCCAGCGAGCCGGCTTCAATTTTCTGCGGTTCCCCATCCACCGACCCTGGGTTATCTAGGGA
CCGGCTCTGGGTATCATCCCCGGTCTTGGACCCAATCTCTACTGCTTGGATCCCAATCCGACGATCCCTCTGTAGAATTTTTCGTGGAGCTGGGTATGGA
GGCCAATCCACCAAGGGACCAGTTGGCTCCGCCGGGAGCTCCATCTCCCCGAGAGATTCGATCTCGGTAGTCGCCTCATACGCCAGATTCTTCCATTCTC
TGTAGCGACGGGATCCCACTGATACATATCCAGGCCGCCTAGGGATATCATCCTTCGCCAGCCATCGCCCAATTTCTTCATAGTGATCCAGTAATAGTCT
CTTGTCGCTGGCATTCGTGACCTGGAGGTACTGTGATCGACCTGGTCCTTGGCTTACTGTAGGCACCCACTTCTCACCCCGAGTGACCCACAGCTTCTCA
TGTTCCACCCACTTCAACCGATCTGGAAGTTCCCAGGTCTCTCCGGGCTCGGTCCAGGTCGTCTTATCCGCCCTTATGATTATCATCTTCGCCCTGTAAA
ACGGTCGCCGTCCGCTGAGCTGGATCGGCATCTCGTCCGGGAAACACAGTGTCCCATCCGCCAGATCCAACCTTACTCCGGCTGGTACCATGAAATTCAT
ACCGAGGATGGCGTCTTGACCAGCGAGGTCTCCAACCCAAATATCGAACCAATATACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTC
GTACGGTACACGAGCTCACCAATCCCAACACAATCTTGGCTCCGACTCCCATCCACTTGGCATCCAACCGTACGATCAAAGGCGCTGTCTACTAAAGACA
CCTCGGCGCCACTATTTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCCTGTGTGAACCTTTTTCCTGAGGCATGGTACTTCCA
CTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACC
TCACCCTTGGTAGGCTCAAACCATCGACCATGCTGGCGCTTCTCCTAGTAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATC
TGGCAAACTCATCCACTTATCGCAGACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGG
ATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCT
CGGCCACTTCTGGCAATATTCCTCTGTGCTTGGGTGGACCAAACCATTGGCGGATCTGGTTGTAGAATTCCTCCATCGAACACTTGCCGACGTCGTGAAT
CTCGCCACAACCGCGACACACGTAGAAGTAGTGGTCTCCATAATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCC