Description :
From Genome Similarity Track
Location :
Scaffold_278:20993- 22283
Transcript NameFunction/comments
Phyta_totarag6602hypothetical protein PHYSODRAFT_525302

Sequence
1290 bases(100 bases per row)
CTATTCCTaggaacaagaagaagaccatgACAGCTCCGCCCGATTCGCGATCCTCGGGCTTCAGCATACGAGGTGCCACTCCCATTGTGACGGTCGAAAG
CAGACCCGTGGAAATGCCGATGAGTAGGTTGAGCACGATGTTGAAGGCCAACGCGCCCATGCTGCCGAACGGGAACGCGTAGAACGACGTGCCAGCCACG
CCCATAAGTAGCAGCGGAATGAAGGCGATACGAAGTACCGACAAGCCGAACGCCCACCCCATAGTCACCACGCGGTACACTGCGGCCGTGCACAAGATGC
GACCGATGAAGTCGCCGTAGTTGTAGCTGCCGATGATACCCGGAGAGCAGTACCATGTAGCCGTGAGGTCGTGGGGTTCGTTGTTGAACGGCGGGGACAG
GTTCCGCGATGCCGCGCAGCCGAAACCCGGAAACACCGAGAgcgacacgaagaagacgaggaactGCGCGATCGCCGGTATCCAGATGATGCAAAAGATG
CGGCCTAGGTTCTTCAGTGTACGGCCGACCGATTGGCTCGccagctgctcttccttGGTCGAGTTCTCGTTGCGGTCCATGAGGAACTTGACCGACGGCA
GACTCACCAAATAGCGGTAAAGCAGGATGGCGCAGATCAAGACGATCACCAACAGACTAAAGAACAGATAAAAGCTCAGCTTCGTGGAACTGCTGGTCTG
GTTCACGCCTCCCACTGcgagccgcagcagcgtggccacCATGATGTTGAGAATACCAGCGCAGGTGTTGCCGATCTGCACACCGTTTGTGAATTTCTCG
ACTGGGAACAGTGCGGCGAACGTGTAGTATGTGGCTTCGGACAGCGAGTTGCCGAACCCGATGCACCCGAAGCACACGAGCACGAGGATTCCGCCGGTCT
TTTgactggagaagctgatggcGCTGAACACCATGATGAGAATGGCCATGACCATGAAGATGCAGTAGCCAACATGCACGCGGAAGCGTTGGCtgaactt
cttgtcgagTCCGAAGACCATCTGAAGCCCCTGACCGAGGACCATGGGCCACGCCGTGCACAGTGTCGTCAGGAACGAAAAGTCGAGTCCGGAGTCCGGG
AACTCGACTGTGTAAAAGTCTTGAGCGCTGAGGCACGAGTAGTAGGCCCAGAGCACCGACCCGTTGAGGAACATGAGCGAGAAGTAGATGAACTTCTCGT
GCTTGACCATGTCGTCCCAGATCTCGGGCGGCATGCCATCGCGCCCGATTTCAAGAGGATCTTCCTGCACGAACTTCTCGGACTTGCCGG