Description :
From Genome Similarity Track
Location :
Scaffold_122:20991- 22002
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_122-fgenesh-gene-0.11O-phosphoseryl-tRNA(Sec) selenium transferase

Sequence
1011 bases(100 bases per row)
TAGACTACTACTCCATGAGGAAGATGCGGCTCGCGATATCACGCACGAGCCAGTCGATGCCTGTGATGAGCCCGTCGCCCGTGAACGCGCTGCAGGACAC
GATGTTCCAGTGGCGGTTCGTAAACTGTTCCGAGCGCAACTCAAGGATGTCGGCGATCTCCGCGGACGACATGGCGCCGGGCAGGTCCTGCTTGTTGGCG
AGGATGAGTAGCGTCGCACCCGCGAGTTTCTGTTGGGTGGATATACACACCAGCAAAGCAAACAAATGTGCACACATGCAAGTCAGAATACAAAACAGTT
GTTCACTTGGTTGTTTTGTTTGCTTGCGCAAAGTTGCGTTTGCTACACGCACCTCTTGCGTTAGGAGCTTCTGGAGCTCGAACTTGCAGTCCTCGAGGCG
TCTTCTGTCTGCGCTATCGACCACCCACACGAGTCCGTCCGTCTAGTGAACAACACGAGTGAGCAATTGTGTTTGCGTGCTACTGACACCGATGTGCTAT
CGTCATATCACACCTGTTCAAAGTAGTTCCTCCAGTACGAGCGGATGGTCTGCTGACCACCGACGTCCCACACGTTGAGCTTGAAGCTACAACACAACAG
TAAATACGAGATGCTGTTAGCACGACCGCCACCACCACAGTACACTCGCACTACAGATACCAGGTAGGTACGCTGCCAAGCTGGCACACATTAACACAAA
GCAAACTTACTCCTTGTACTCGAGCGTCTGGATGTCAAAGCCGAGCGTGGGCGAGATCTCGGTGATGTCCTGCCCCATGAACTTCTTCAGGATCGTCGTC
TTGCCCGCATTGTCCAGTCCGCTGATCACACGACAACACACACACCACAGAGATCGTCAGCAGCAGAGCTCATGTATATATATATACAGTCACGTGCACC
AGCACCAACGCACAGCATGAGCACGCGGATCTCCTTCTCTTTCTCCTTCACTTTCTTCAAGATGCTCAGCAGCCCCATTTTGCTCAATAGTTCCGTTATT
ATGGCCCAAGC