Description :
From Genome Similarity Track
Location :
Scaffold_49:20987- 23879
Transcript NameFunction/comments
g6934.t1RAW23875.1 Vacuolar protein sorting-associated protein [Phytophthora cactorum

Sequence
2892 bases(100 bases per row)
TTCGTGTTGGACGAGCAGGGCGAGGAGGACCTGCTGCGCGAGGCGCTGCAGACCGTGCGCGACCAGGGTTTTCGCATGCAACGCGCAGTGGACACCGGGG
ACCAGCCGGCGGTGCTCAAGCACGCGGCCGAAGTGCTGCGCGAGCTGCGCACGAGTCTGCTGTCCCCCAAGAACTACTACCAGCTCTGTAATGACTTCAC
ATCCATATTAGTCAATACACAGCAGGCTGTACACTAATAGAGTATGGTACTATTTCCCTAGACATGCAGGTGCTGGACGAGCTCCGCCACTTTGAGAGCT
ACGTGGACGAACAGCAGCAGGCGGGCGCCTCCATGCGCGTGCTGTACGAGCGGGTCCAGAGCAGCGGTAACGTGCTGCCGAGACTGTACGAGCCACATAC
TAGTAGTACTCGATACCAATGTAGTATAGTACTACTCACTTCTATGGCTGTTTGTGGTGCAGCTACTTGCTGGTGACGGTGGGCTCGGTGTACATCAAAT
CGAGGGAGGCGCCAGCTCGTGACGTGCTGACGGACCTGGTGGAGATGACCAAAGGAGTGCAGTATCCGCTGCGTGGACTCTTTCTGAGGCACTATTTGTC
TCTTAGTGTCCGTGACAAGCTCCCGGACACAGGATCAGTGTACGAGCAATCGGGCGGTGGCACAGTCAGCGACGCCATCGATTTCTTGCTGCAGAATTTA
CGGGAGACAAACCAGCTTTGGATTCGACTGCAGCACCAAAAGATTGGCGGATCCAGGCCCCTGGCTGTTCGAGAGAAGGAGCGGATGGAGCTGCGACTTC
TAGTTGGGACGAGTCTTGTGCGGCTTAGTCAGATGGAGGGGGTTACGCGCAGTGTGTACGCTGAACAGGTGCTGCCTAGACTCCTGGATGACGTTGTGCT
TGCATGTAAAGATTCCATGGCGCAGCAGTATCTGCTGGACTGCATCATTCAGGTCTTCCCGGATGAGTTCCACCTGCAGAACCTTGAGAGGCTACTAGAG
GCGATGGACAAACTGCAGGAAAACGTTGACGTCGCGTTGATCCTGACAGCGCTTCTTGAGCGCCTTACCAAATTCCGAGAAACGCAGGCTAGTGTGGCCA
ACACAGGACAACATGAAGCGGAGGTAGATGGTCGGACCAAGCTTGAGCAGGAACAGCAAGAGGGGTTCAAAGTGTTCAAACAGGTGATGGCTACGGCTTC
CAAGTTGCTGCTACGCTCGTCGCGGTATGTTGTTGGAAGTGGAGAAACTCCAAGCCAAGGTGGTGGTGACGCACACCTGGCGTCCGTATTGCCCTTTTTC
GTGACGTTTGCTACGTTCGCTCTCACGTGGCTGGGTACCAGCAAGGCCAAAAACTCAGACACTACGGAAGCGCTACAGCAAATAGTTTCAGGATGCTTAG
AATTTCTTCGAGAGCGAACAGCGTGGCGTGTTGACAAGGATAAGCAAGTGCGGCAGCTTGTGGTTTCACAGCTGGAGTCTCTTGCGCTGACGCTTCTGAG
AGCACTCTCCATCCAGGATCTGATGCAAGTGCCAGTATTGCGTGAGATGCTTGCTCTGATGCCATGGCAAGGCGCGTGGAAAGATGTAGCCCTAGCGTGG
ATCCGTGTGCTACTTGCGCGGCACCAGCGTGTGCACAACGAACAACAAATGGACTTCTTGCTGCAGGTGCTTTCGCCACTAGTACGAGACGACCCCAATG
AATTGCAATCGCCGCCCCCAACAACCACAGCGGAAACGGGAAAAAAGAGTGCTGAGATTTTTGAAGCTGAGCAGCAAACGCTGGCAAAGGTTGTACACCT
GGTGGCCAACGATGACCTTGACGTCAAATTTCGCGTGTTTTCTGTAGCACGACGTGCATTTCTGCAGAGTGGAGTCTTTCGTATTCGTTTCACGCTTGTA
CCGTTAATCTACCAGTCGCTGGCTCTCGCTAGGGACCTAGCCGCCCACTCTCAGGAGAAGACTCAAACTCAGGGCCAAGAGACCAAGGCGGAGTCAGAGA
GTGCTGCTTCGGTGGGGAATTCCAAGACGTTTGTTACAACTCCGCGTGAAGTCCTGCAATTCGTTCATGAAATGGTGACCGCGTTGGCTTCCAAGCAGGA
TGCGCTGTCTGTTTCGTGCGTCCACTTGTTTCTGCAGTGTGCTATGGTAGCCGATGGCTGTGCATTTGAGGCAGTCGCGTATGAGTTCATTACGCAAGCT
TTCATTGTGTACGAGGACCAAATTACGCTTGCACGTGAGCAGTGGCGCGCACTAGAACTGATGGTGGCGTCACTGCGTTCCACCCGCAACCTTTCGAGCG
CCAACTATGAGGTTCTCGCTACCAAGACCACACAATACGCCGCCCGACTTCTCAAGAAGAACGAACAAGCTTTGATGGTGTTGAATTGCGCGCATCTCTT
TTGGGTGAGTGACGTTGAAGAGTGAAAAGGGGGTCTCCGCTGATGTGAGTGTGCCGACGTTCCTGTACTGATTGTACTCATCGCTCTTTTGTCTTGCAGC
ACCCCTCCCAACAAGATGGCAAACGCGTTAGGGAATGCCTTCAGCGGTCGCTGCGCATTGCGGATGCGATCAAGGACACAACGTCAAACCAAGTCCCCCT
TTTCCTGGAGATTCTAGAGGCCGTACGTTGCCATGGCTGCATTGCTTGCCTGGCCGACACTCACTCTACTTTTTTGTTTTGTTTTGTGCAGTATTTGTAC
TTTTTTGAAATGCAGACGCCCGAGGTGACGCGCAACTACCTGGTGGGGCTGCTGACCCTCGTGAAGGATCATTTGGACAACATGGAGCACGGGCAGATGC
GCCGAGAAGGCGAGTTCCGTTACCGCGCCATCGTGCGCTACATGGACACCTTGGACATCTCCGATGATACGCTATCGACCTCGCCGTCGTCT