Description :
From Genome Similarity Track
Location :
Scaffold_283:20986- 24825
Transcript NameFunction/comments
Phymu_g8044hypothetical protein
Phymu_g8045hypothetical protein PHYSODRAFT_498950
Phymu_g8046conserved hypothetical protein

Sequence
3839 bases(100 bases per row)
ACAGCGTCGACCAACTCGGCATGTTTGTCCTTGGTGATCAACTCCATTTCTACCTGCTCGAACGCAGCGACGTAGTTGTACTTCACGTATCCCAGCCTGC
ACGATTTAGCAAAAATACGCGTCAGAACTTGTAAAGTAGCACTACCGGTAATATGCCGATATTCATCAGGGGAAGTCTCACTTTTCGAAGAGCTTGATTG
ACGATTTGTTCGTCTCGATGATCTTGCAGATGAATCGGCTCACCTTGAGCTCCGACGTAGCTGCAGACGTACATGAATCAATGCATCAGTCCTTTAGCTG
TTAAAATCCAGCATCCCTAGCTGTCACTCATACCATAAGCCATCATGAGCTTCACTGCTTCCTCGGCAAAGCCCTTGCGGCGGTACTTCTCCTCGGCAAT
CatgatctccatctcgcACGCGAGTGGATCATCGTAGTCGTTAAAGAACAAGTTAACGTCCCCAGCCATGCCTACAACATGGAAATAAGTCCTTCCAGGT
CATATTTAACTTCCAACAGTGCTTGCAACTTACGATCAACAGCACCCTCGTCGATGTACGATGTCTCAGGCTTCCCATCCTCGTCAGCCTTGGCTAGTAC
GATGAAGGTGCACTCTGCAAAAATATATTAAACATAATAGAAGAACTGGTTAGTCCCCGGTTGCATTTAACTCAAAACTTAACCACCCTGTTCCGCACTC
TCGGCATCTTCTCTCCACGACTTCTGCATCTCAAATTCCTCATCAATAGACAGCGGCTCGGATGCCGTCATCTCTGCGACATAAATACACAAAAAACATG
AGCTCATGTACCACCAGAAATGGACAGGTTGAGTGCAGCGCTGTGCCTTGTAGCCACGGGTCCTTCATCCAGTTGTGGTACTTGGGCACatgctccttct
cgtacggTACTAGCGTCACCTTCTGGCCGGTCTACAGCACAAGTCACACAGCGATATTCTTAATAAATGAACAGTAGAGAACAATGAATAGAAGAACTTA
TGGTGTACGATGACGACGCCTGCGTTTGCCTTCATTTGGACTGCGAAAATGAGACGATGGTGTGGTGAACACGACATTCCAGAGTATAGTTGGTGTGGTG
GACACTAAACTATTATCATGTCTTTGACAATCACTCTCAGAAATGCTCGGATCGACGTCCGACGCCGCACTTGAGGCGCAGCTTGCGGAGATTTTACGCA
TCCTTATTCAGCACAGATGGCTTCAGGTAATTACCCGCGATGTTCTTGTTACAATGATACATTGGATTGACTCCGTATTGGCGTGGGCGTGTAGGTAGAC
GCAATTGAATCTATCTCACTGGCGAGTAAAAGTCTAcgggagaaggtggagcagcagaagctgctacgGCTGGCGGTTCGAGTGGGCGGGTTTCCGCCCA
TGTACAGGCTCCGGTATGTGACATATCAATCTGCTGTAGACGTGAAGCTGACGTCTTGTTGAAGCTATTGGCTGCAAGCTGGAGATGTGAAAAcgctgat
gaaggagatccCTGCTGGACTGAGCAGTAGAGAACACTACTTCAAGCTGATAGGCATTGACAGTCTGGAGGGCAAAGCAGGGCTGGAGACTACGGGAGTG
GAAGGAGAAATCGATCGAGATATCGAGCGGACTTTTCCTGCGAATCCTTTCTTTTCGGAGGAAGGTTGGTGAAGCGTTTGTTTAAGATTGAGCAAATGGT
GGTGATTGATATTATTTTTTGTAATAGGTGACGGTAGAAGGCTGCTGAGGAATGTATTGAAGGCTGTTGCTCTTCACGCCAGTGACATTGGATATTGCCA
GGTACGTGTCAATTCGATAAGGATGTTCTTGAAGTTGGGAAGCTAACAAAGTCAATATGTTTGAAGGGGATGAATTACGTCGTCGCTGCGTTGCTACTTG
TGGTGAAGGATAATCAAGCTATTGCAGAACTGGACTTGGCAGGACTGTCGCATCAAGAGGCCGTATTTTGGCTGACTATCTCCTTGATTCGGCGCAAAGG
GATGGCAGATCTTTGGAAGCACAAGATGCCAGGGTCCGGTCATATTTTTTGGGAAACTATTTTTCGACTGAAAAAGCTCATTTTGTGGATGTTCTCTCCT
TACTCAGGCTATCGCAGTGTATTTACCTTTttcagcagcttttgcagctgcaCTTCTACGATCTATCGGCACACTTTCGGCATATTGGTATGCATTCAAG
CGTTCTCGTCACCCAGGTAATTAAACCCTGACCATCATCATGTTTATTGAGTTCCTTACTCttgctactacatgtacgttgcAGTGGTTTGTGACGGTGT
TTGCTCGTGTGCTTGCCACCCCATCACTTACCCGAGTATGGGATCTTTTCTTAATTGACGGTTGGAAAGCTGCGTATCGAGTCGCTCTTGCCATCACAGC
GGAGTTGCGACCGAAGCTACTCGCAATGGTAAGCTAACGTAAACACAAGGTTACTCTCATCATTGCTCATATTCGTTTTGCTTGTTGTAACAAGGACTTG
GAGCAGTGCAGCGAGTTTTTCCGTAAGAACCCCAAATTGGGCCTGGAGGAAGCGCTTAGCCCGGATGCATTACTGCAGCGTGCACTAAGCTATAAAGTGA
CGCGTAGTAGCCTTACACAGCTGAAGGAAGAGCGGCATCTTGAGGTACGACAATTGCAAGGCTATTCGCCAACCAATAGCGTGGTTTCAACTAATTCTAT
GCTTGCATTTGTCGCAGTATCTTAGACTTCGCCTGCAACAAACGCCGCTTTCAGATGAGCATCGTATGCTGTTTCCTACACTTGAGCACGACGAAGATGT
CGCTGCCAAACGAAAGTCTCTGGAGTTGATCCGCTCTAAGTTGCAACGCTTTGACACTGATGTCGCGAGTGATACAGTTTTCCTTCAACACAAGATTGAA
GCAGCGGAGAAGGCTCAGGCCACGGCGATGTCGGTTCGCTATGCTATCGCATACGAATTGTCGGAGGCAGCGATTGAATTGAATGAGCGTATTGAGATTA
AAAACCGCCTGCGGTCAAAGTTCCGCAAGCTCATGGCAACGGCAATCACCGAAGCAACCACTGGATCCTCGACAAGCGGTACATCTTCGGTTTTTTCGAC
GTGGATCAATCCATTCGATTTCATTAACGAACGTATGGCAAGTTGCTTTGAGCGTCTGCCACTGCTTTCAAGCTACATTGATACTGgggacgagctgcag
ggaGGTGATAACGACactgacgacgaagaagacgaagaagcaggacggAATTTGAAACATCTCGAGATGTTGGTGCCCCAGTTGGCAGCGGAGTTGCGTC
TGTTGCAGCGTTCGTTGGCCTATAACGAGCGCTTTTTGCGCCCCATGCTACAGCGAACTCGGCGGCTCCAGCGTGACGCTCAACTGGCACGAGTTGAAGT
AGAAGAGGCCCAAGTATTCAAAGACAGATTAGCCgaccagttgctgcagatcATGCTGACAAgtgagaagctcaagaacgagcggatgcagcagctcttt
gcTGAAGTCGACAAGAGCGCTAACAGTGCGTGAGCAGTACGTGAGCTATATGCGATAAACGTTGGAAGTATCTACTGTATTACTACCGGTGTGGAAGCAG
GCACGCGCTACAGTAAAAGTCAAGTGACGCcacaagctcttccttggcAACAAGCGAGCGCCCCTCTCCCTTTATGCATGCTTGGTTCCGTTCTGTTGTT
TGTCCAGAGGTGGTCACACTTGAGCTTGACCCACTCCTATGAGAAAGACTTACTCGTCCTCCGTAAcgacgtcagcaccagcgaaCTCGGCCGCCACAGC
AGGCTCAGCAGCGACAGGAGCAGGCATGCCCGGGCCcca