Description :
From Genome Similarity Track
Location :
Scaffold_323:20984- 23046
Transcript NameFunction/comments
g11976.t1hypothetical protein

Sequence
2062 bases(100 bases per row)
TTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCC
GCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACG
TTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAG
ACATGGTGCTCGACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTT
GACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAAT
CTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGCCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTC
AACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAG
CTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTT
GGTCTCGCGACGTATACTCGAAGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCCTGAGCACCA
GTCGGCTTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGAC
TTCGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATC
CGGTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGC
GTCGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCG
GGCAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTG
TGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGCTCCGA
GATGATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAGGAGGCCTG
CTGACATACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATGACGCTCCCA
GCGGCGGCCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGTACGCTCCTG
CGAAGCGTGCCAACGAGTCAAGCCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGTATGGACTTT
GTCTTCGGGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCGCTGTCACCA
TCACCGCGGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCG