Description :
From Genome Similarity Track
Location :
scaffold_4:209829- 212044
Transcript NameFunction/comments
Plaha_PHALS_08543Extracellular protein SEL-1 and related proteins
Plaha_PHALS_08544trimethylguanosine synthase

Sequence
2215 bases(100 bases per row)
GTCTCCAATATATTCTGTAAAAGTTACAAAGCGATCAATATCCACTTTCGATTTTGCATCAGGGCGGTTTGTCGGCTGCTCGAAATTTAGCACAATTGTA
TGATTCTGCAGCAACGAGGTCTTTTCTGGAATTCCGGTGTCGATGTTTGGCAAACGAATACCAACTAGTTTTGGAATACAAAAGTCAGAGTCAAATTCAC
ATTTGAGCCCATCTTCATCCGGTTCTTCAGAATTCTTATCATCTTCTTCTAGTTCCCGGTCATCCGTGCTCAGTTGCGTGACTCTTAATTGCCCAGAGGC
GACAATTGTGCCAGCTTGTAGCTTGTTCTCTCTCTGGAGGATCAGTTGCCACTTGAAATGGTCATGATGTTCGTATATGTTTGTGGGCTGAGATATGGGG
AATCGAACCTTAAAGTGGAAGACGTCGAGTGCGCACACGGACGGCACAGTCTTAGCACTCCAAGTCGTCAACGGGATACCTGCATGCCACTCGGCATTAC
TAATTTGTGCATGAGATTCCTTTCGACTCAGAAACGCCGCTAGGACGCCTGTCACAGCGTTGACGACGCGCATGGTGGCTTTGAAAGATATAATGCGCAC
TTCAACAATTCCCATGGCGTCTGGGATTGGTGGAAAATTGTTCAATTGACATCCAATGGATTTGAATCAAAAACGCATAATGACTCTGCTGAGTGAAGTG
CAACTCCGCAGCCGCGAAACGCCAAACAATCAGGTGAAGTAATTGTCAAGCCTCCAATTGTTGGTAAATATGTCACTAAGACGATGCAAATTAATAGTTA
AATGCCTTTTATTCTTGTAGCTTaagaagagaaaaaaaagCAAGAAGAGACGTAGACTGGCGAATGGTGATGTGTGTGAAGatgcaaaagaagaaaattc
cTGCACTGATCTGTATAAAGCTGCGCAAAATCAATTAAAAGAGGAAATGGAGGCAGCGGGGATGGTGGGAACTTTACCTCTCAGTTTTGGTGGCAGTACA
AAGCTAAAGACATCGAAAGAACGAAAGCgaaaaattcaaaaaattgaACAACTGCACGAGtctgaagaaaatgaaatgACAACATATGCGTCGAAATGTA
AAAAAGTTGACTTTGAAGAGGAGGAGGAAAACAGTGATGATAAAAACGTTGTTCAAGTTGCCGAAAAGAAAGCTTCAATAGTGGTGACCGAAGCTGTCGA
CGAGGTACGCGTGATGAAtatttcaaatgaagaagtGATGGAGCAAGTGATCAAGCAAGTGGAGGTGATTGAGGGTAGTATACTAGAAAATCAGAGTATA
CGCGTTTTAAAGCATgagaattcaacttcaaactCAAAAAATTCCAGGTGTCCAGGTAGATTTTTGATTGCGCTACGGCTTGTTGTTCGAAATCAGTGAT
TGGGTTGTTTTTAGTTCCAAAGGATGTCGCCAAGTTTTACGTGCAAAGAGACATTCTTTTCGAGAAATTCAACGATGGTATTCTGCTTGACCATGAAAGC
TGGTATTCGGTGAGTCTTCTTGCTTTTCAAGTTTCTTAGGCTCGAACATGTAAGTGACTTTGCTGTGTCAACAGGTAACACCTCAAATTATCGCAGAACA
TATTGCAAAGCGCCTTGCATGTGATGTTGTCATCGATCCTTTTTCAGGCTGCGGTGGCAATATAATCCAGTTGGCAATGACGTGTAAGCAGGTTATTGCA
ATTGACGTTGATCCAGAAAAAATTCGCATGGCGAAACATAATGCGACTATCTATGGTGTCGCGCACAAAATCGAGTTCATTGTTGGCGATTCCATCAACC
TTCTTGCCAAACTTAAAGCTGATGTCGTGTTTTTATCGCCACCATGGGGAGGGTTGAAGTACAATCGAAAGCAATTTAAGTTGGAGAATATGCTTGTAAA
TGGGCTAACTGGGCAAGAATTGTTTGCAAAGGCTCGTCTCGTGTCAAAGAATATTGCCTACTACCTTCCAAAAGGTACACCTGTGGAAGACTTAGAGGCG
CTTACACCTGGTGAAACTGTGGAATGCGAGAAAATTTTCCTGAACAAACAGCTCAAGGTCCTTACTGCCTATTATGGTGACTTGGCTGGATCAATTTCTG
ACGTCGACGATGCCTTGCCAAATGAGGAAACGAATTAATAGGCGCTCAAGATAAGTAGGACAGCTGAGGGCCGAAAAGCGCCGCATCCAAGTTAAATGTA
ATATGGCTGTATGAA