Description :
From Genome Similarity Track
Location :
Scaffold_79:20982- 22935
Sequence
1953 bases(100 bases per row)
CTTGCTCGATCACATCTACGCTTTCATCTGGCGGGTCTCCATCCACTGGTAAGCACATAGAGTTTCCTCCATCTCATTGGCGCCGTCAATCTCAGTAGAG
TCAGTCGTTTGGCCAGCTCGCGATCATCTAGCGTAACAAAAAACGTTTACATGCTCGCGACGTGTGGCCGGTGAAGATAATTTTCCTACATAGATCGCGA
TCTTGGCCTGAGCCGCCGCGACGTTAAGGCGATGCATATATTCTAATGGGGTTACGTCCAATCGCTTCCGTGCGTGGTAATATTGTCTGACCACTGACAT
ACCCTGTCCCAAATACTGTACCGGAAAACAATTCAGAAACGGCTTCCATTCACGCCGTGTATATCGAATCAGCTGGCTGTACCAATTTCAAACAGGTATT
GTAGGAAGATCGCCAACTACTACACTCATTGCTTCTTCCGGCGCTTGATCGCGTAGGAACGCCGACTTGACTTTACTGTCCCGTCTTCTAGCCCGATCTT
CATCTCTATCCTTGCCGCTAACTTCCTTGAACTCCGTCAACGACGACACACGTGTATCGCGTCGTCGGAATGGATATCTTCAGGATCGTATGTGTTAGGT
CGACTGAGATGCGATCCAGCCAATCCCATCTCGATATCTGGAATACATACTTCTTGAACTCTTTCATGTTTCATTCTCTCACTTAGGTAGACATCTTGAC
GGGCTTGCGCTCATAGTTCCTGTTGGAACCGTTCCATGGCCGCGTCGGAGTGGGACTGCAGATTTACTTGAAAATGTATTGCGCTCACGCTAGCGCGTAC
AGCTGCCGATAGTGGTCCAGTCTTGATCTTCCCAACCCGATCTCAAATGTGCCGCCCCACTTGGACGTAAGGATATGCCCTGAATGCCGATGGAGTCGTC
TAGATCAATTTCGGATTCAGCCGATGGATGCTGCGACGATCCCGTGTGGTATTCTCGCAGGATATCTGCAATAATAACTTCCGCTTGATCCAAGTAGTCA
CATTAGCATGTAAGAAAAAAAACCTCATAAAGCAAGTGACACGCATGGATCACTTGACTCTGTTCACACTCCAACCTTTTTTACGCATCGAATGCTCCCG
CGACGAATCCAGCGTCCCGTAGCAGCTGAATAATTCCATCGATCCCTTCCAGTGTGTTCGACGCTACAGCTGGGGCTGGTACAGGACCCTGAAATGTGCC
GATCAACTTAAGCTTCAATATCTGGTGCACGGGATCTCTCTATATCAAGTTCATGAGCGTCTTTCAGTAAAACTCCTTCGCCAGAGCACGTCTAGTTGCC
AACCTTATGTCTTCATATCGTGTTCTACAAACGTGATCGGTCCAATAGCCGATCTCGTGACGCGATCGTGTAGATCCTATCCTAGTGCTTCTTTCTTCTT
CACTCGTCTTGTATTCAGATTCATGGTCGTCAATATTGTTAGAGTGGTCCTGGGTGATAATTGTTCGGTCTACCCGAAGGATTTTCACCCAGGAAATCGT
GTTTTGCAGCACGATTCGCGGTGGTTTCCGGAGGGAACTCAGGAGAAGGTCAAAGTTTCTCTTCCAGGTCGACCGATCGATCTTTCTCTATAATTTTCTT
GTCATCAAAACAGACGAATAATTTTAAAAGATCGCCGGGTCATCAGACCCCAAACTCTGAAGATCCGGGGATCTTTTAAAATCATGCGGCCGTGGCGATT
CCTCTGCCTCTGACGCCTACGTCCCAGGTTCTATCTTTACCTTCTCATTCTCACTAAGGATCACGATTAAATCCCGAGTCACCAGAAGATCCGGGCACGC
GCATCATTGTGGTGGAGTAGTATTTGCTCGTTTTCTGATGCAATCCCAACTCTCCACTGGCACCCAGACGACCGACTATCGGAGGGGGTACTCCATATCC
GACCTTGTGTACCCGTCGATAAGGCGCATTACACTCTTCTCGGTGGACTTGCG