Description :
From Genome Similarity Track
Location :
Scaffold_215:20981- 22112
Transcript NameFunction/comments
Phyke_g6658hypothetical protein PHYSODRAFT_262310

Sequence
1131 bases(100 bases per row)
TTGCATGATTCTCGCCTACTTGTACGGTGTAAATCATACCGTCGGCCAACCACTCGAGAAATCAAGCTTGTTCCAGCCGAAACGCTTATCTCCGTCCGCG
TATCCAATACGAGTGTCCACTACACAATCCAATGAACAGTtagaagaagaggagcaaAGCGAATACGACAATAAAAGAATTGAAAGGGCCACTTACCGTA
GTGATAGTACAAGATAGGACCGTTCTTGGGGTCGTTGTACACACCTTGGCCACCCGGCCCGTAGACAAAGTCGTGTGATTCGAGCACGATTGTGCCGCCG
TTGTTGCGGCAGTCGTTTCCGTTCTTGTCGACAAAACCCGACGTCGCACTCTTGGAACGGCACACGAGAATGCGGTACTCCTTGCCCTTGGCAGGCCGGG
TCTTGTCGTAGCCACAGCACGATCccttggagaagaagaggtaGTAGTAGCCATTGTACGAAAACTCATAGGCAGCCTCTACAACCTCAAAGTTCGAGTG
AAATGCCAATTGAGTTCCTGCTTCGCCAGTAGTTTTCGTTGGGTTTGATGCCATCTTAACCTGGAAGAGGTCCTGCCAATAGCTACCAAAGTTGACGTAG
TATTGGTTGCCCACTTGGAACAGGTTCGGGTCAATGGCATTGTAACTTTTGGAGGAATCACTTGTGATGCCCACGCTGCCGAGATCCGTCCACGAACCCG
CTTCCATGGTTTTGGACTGTGTAAGGCCGATTGCGGAATTTTGCGTCCCGAAACTGCTCACCGAGTAGTACAGGTAGTACGTGTCGCCAACCTTGTGAAC
ATCAGGCGCCTAGGTGAAAACGCACGCAGATGAGAAATGTCGTCAGTGTTGAAATCGAGAACGTTTGAATACAGAACGGTGTCCTCACCCAAAGATCATC
TTTACCGGCCAGATTGATGATAGAACCGTCGGGAACGGCAGCGCCTAGATATTTCCACGGGCCTGAGATCGCAGGGGCCGAGTGGATAGCGATCTTGTTA
CCCGTCGAGAAGCGGAAATACGTGCCATCGCCGCGCTGAATAATGGAAGGGTCATGGGCGTTCGTACAAACTCCGGTGCAAGTCTCAGGGTTGGCATAGC
CGTTCACGACACCGGCAAGAACCAGAGGGAG