Description :
From Genome Similarity Track
Location :
Scaffold_119:209792- 212599
Sequence
2807 bases(100 bases per row)
TCGCTAGCTTTGTACTCTTTTTCGACGGGTCGGCGAAGACAGAGAAGCATGGCGGTTATGGTAGCTATTCGTGGATGCTGTAAAAATTCACTGGATGGAC
CATTATGATGGCTGCGAGCGTCAAACTGTCTACAACTACGGTCGATCTGATCGAGCACGCCAGATTGAATCAGGGCACAAAAGCAGCATTCGAACACTAC
GTGACAGAATTGATCATCGTCGGCAACTCCAGGCTCGCGATCCAGCAATCCATGGGGTGATCGTATGCAAGAAGGATTCATTACAGGTGGAACTAGCGTA
TCATAATAAACTGATCGAGCGGTTTAACTCCGCCCGCTATCTCCTTGTAGCACGTTGCTATAACGCAGCGGCTGGTGCGCTGGCTACAGAAGCACTAGAA
TACTAGGAGGGGTAGGTAACATAAGATCAAGCGCGACTGACGGAATTGCACGAGATGAATCGCATACGGGAGAAATTACTTGTCGAGTCGAATCTGGTGA
CTGGAATTAGTGAAACACCTGCGATAGCAGCTACAACACGGATCGCGACTCGAAGGGTTCCATTTTCTGATCTACCGACCCAAGAGCGTGGTCACACGCC
GATTAATATAGGAGATCGGAGGGGCAGGAACGAACAAGCACCAGATTTCTTGAAATTAAATGACATAGGCGACAAATTATTAATGGCATCTCGACGATTA
AAGACTCGGCGGGAAGCGGAAAAGCCGAGAGGGGCACCCAAACGTCGAGGATACCACGTATAGAAGACATTGACCCATTGGTAGTGCAAGCCGATCGAAG
AGACAAGATCTCAATTGCTCAAGGTGAGGAAAGATAAGTGGTTGACACTCAATGATTTTCTTAGAAGAGAGGCCGACAAGATGACCCATAGAAAAGTCAG
CAACGCAGGTAAATTCGCAGACCAGTTGTATGGATGAAATGCTTTACTATCTGAGCATGGATGAAATGCTTTACTATCTGGGACGACGTCGCGAGTCGAG
GGAGTCACCCGACAAAGGCTTGAACTGCTACTACTGGTTCTGACTACTCTGATCGATAAAATTGTGCTGAATTTAATTGATTCGTGGAAGGCGGGCATCA
AGGGATTGTGCGAATATATCATCGAGTAAAAATCGACTACTACTGGGCCGGGCTTTTCGTCGACGTGACAGGACATGTACGGGAATTCAAGGATTGCAGT
ACCAGCAAGATCGAATCTCACTTGATAGAATAAGTACCAGTCAGCGTAGTATCTGAAATACCATTCCAAGTGGTATCAATAGACTTTTTCATTCCATTTC
CTGTGACCCAACGTGTAATCACAGCGTTGTTGCTGTTCCAAGATCACTTCACGGAGTTCGTGCTATCCAAAGCTAGGAATGCCACTGGAGCATTAAAGGT
TGCGGAGGCTTTCGAAGAGAACATTTTACACCGATTTGGTGTTCCAAGTCTCATTCGTCATATAAGAGACCCGAGATTCATGAGCAAAGTTTTCCAAACG
TTCGCCGAGATGATAGGATCGAAAACAAGGGCTAAACTGAGCTACTGACCACAAGCGAACAGGCACCAAGACCGGCGCGTGAAGACAATGATGTGTACGG
TGCACGTGGACGTGGACAAAAATTCCGGTAAAAGCGGATTGAGATGATATTGCGGTGCTGGTCCCGTCATCAAGAATTCCAAATATGCGACGAGGAAAGA
GACACCGTTCTACCTGGTACATGCCTGGGATGCTTACTCTAACCTAAAGGCCATGAACGAGTCGATTCAATGACCTCCAAAGAGTGCGGATAAGGAAATG
AATTTGGCAAATTCATTTATGTGGCGCCGCGAATCTCACAGACTGCGAGAGATTGATTTCTAGATCTCAAAAACCTACTAAGTGGACGCACGAGCTCGAC
ATGCAAAGGATCACAACAAACAACTCAGCCCAGCCGTATGACAAATACTTTCGAGAACAGACCGACCTGAGCCTACTACGGGGACGGATCGACAAGTTGG
AGATGTGTTCACACCGATACAAACAACTTTCGAAGAAAACGTTCAAGAATGGCTGTTCATGAAGAGGATAAAACCATCAATTTTGCTATCAATCTGGCTC
CAATATTGGTCATCGATCAACATCTTCTGACTTCGAGTCCTTGCACTCAAGACCGGCCGTGATGTCACCTCGCTTGATCAGAAGAAGCTACGAGTCCGTT
CTGTTCTCTTACGATGCGCTAAGTTTCAGCAGTGCAAGATCGAGACGTATCACTATCAAGAAGTACGAGCATCTCAATACATTCCCACCGTCTAGTTTGT
CGACTACTGTTTACGTGACTCAAAACAGGTTCTTGGAACAATTCAATCAGCAAGAGCATCACACCACGATACGTTCTTGATACATAGACAGAGGAAGAAG
TCAATGTGTGTCGACATGATCGTTCACAACTGCACGCAACAGGTGCGACGCCAAAGCTTTGGACACACCGGGGATTGAACCCGGGGCCTTCCGCTTGCAA
AGCGGACGCGCTACCACTGAGCTATGCGCCCGCAACATAGACACGTCTACCGACAGCTTTCACAACGCTTTATTGCGCCATACATGTGTGATTCGCTCTC
CAACGCGCTGCTACAGGTCCTGGCAGTCGATTCCGACCTCCTAACCTTCAGATCTCGTGATTTGTCGACCAGTAGAAGACGACCACGATCTGTTGCCTGC
TGACGTCGAACCAGCTGCCTGTTGTCGTCATTCATTAGAGAAGATCGGAAATCGGTGTTATTCAGTCGAGCACACTTCACAAACAGCAACCCCGCCCGTT
TTGTTTT