Description :
From Genome Similarity Track
Location :
Scaffold_14:2097593- 2100997
Sequence
3404 bases(100 bases per row)
CCGTCGTCGACATTGATCGACGACGTGAAGAATGCGTATGCGAGTGACGCAGACGCGAAACAACTGCTAGACTATGTCTTAGCACCCTCCGACGAGTCAC
GTCGGAAGTTGTCGTCACATCTGCGAGCTCGCGCACAATGATATCGGTGTGCACGAAGGATTGCTGCTTCACAGCGCAATGGACGACGATGCGATCCGCA
TCGTCGTGCCGAATGATTATGATCTGAGTATGCGAATCAAGTATGTGTATCATACGACAGGGAATCCGGGCCATGAGAAGACATACACTCTTCTCACGAG
GGGCTTCTTCTGGAACCACCAGTACAAGTGGGTGCGCAAGTACGTACGTGCTTGCACGGTGTGACAACGCGTGAAGCCTGCTGGTTATTCGCAGGCTCCC
CTACAATCACTACCGACACCTTCGTAGTGACGACAGTCCATTTCTATGGACTTTGTTTTCGGGACAACCAGCGGAGGACTGGCGTTGTGGTCTTTGTTTA
AGGATTCAGCAAGATGGTCCATCTTGCTGCTGTACCGGCTGAAGTCACGTCCGTGCCGACTGCACGACGGTTTGTTGACAAGGTGTTCTGCCACTATGGA
ATACCGCTCGACATTTTGTCGGACCGTGATCCACGCTTTACAGCGCGGTGCTGGCAAGAAGTGTTTACACTTCTTGGAACACAGCTGATGTCGACTGCGG
ATCACCCAAAGACGGACAGTCAGACCGAGCGCGTGAATCGCGTGCTCGGTGACGTACTGAAGATCTACGCACACTTGTTACCACAGTGGAGCGACTGTTT
GCCGATGGCAGCGTTTGCCATCAGCAACTCGGTGTATGTCTCGACAGGGCAAACACCGTTTTACGTGAATGCCAAGCGGCATCCACGCCTACCCAGCTTG
CTCGCAACGGTGTGTTCCCCCTTAAATGTATGTGTGTGTGTGTGTGTGTGTGTGGAGAGGGAGGTTGCATCGAAACAACCGCAGAAGAGCACTAATACCG
ATGTGGTATCAGCGGAGGCGACGTGAAGACAAGCGTCTCGTTTCGGGAACGAGGTGAAGACAGGGAACACCGTGTCTGTGCGGGACACAGGCACCGCGAA
CAAGAAGACGTCCGTACCGGGTACAGGCAGCGGCCAGGCCGGGCCTGATGCGGAAACAGACACGTCTGTGCGGGGCACAGACAGTGCGCAGACTGGGCCT
GATGCGGAGAAGGAAGCCGTGCTGAACAAGTCAGTCAGCACGCAATCACCGGACATTGTCCAGCGCCGACAAGCCGTAATAGGGTTTGTCCAGGACACAA
TAGCAAACAATGTCGGCAGAGGTAACACAAATTAATTAAAAAAGGGTTCATTAGTTCTGTTAGCTACACATCACCTGCGGCGACATGCCGTTTCTGACTT
CGGTGCTAGCAAGCTTGCTGCGCGCTACGTCGGTCCGTTTACAGTGCTTGAACGGCATGGCTACGCGTAAACGTTGGATATACCGTCCAGCGTGTGACTC
CATTCGATATTTTACGTCGGGCGGTTAAAGCCTTATGAGCACCATGAGCCACCAAGGCTTGATGGCTCGAGGGTGACGAAGCGACGTGAGCTAGCTTCTC
GAGCGCGACGACGCGGTCGCGCAGGCGTCTCAGCACCGATCCAAGTGCAACTTGGATGTTAGAAGCGGTCTGAGCAGCTGCGGCGACCTGCGCTTTCTGT
AGTCGCAGCTCCGGTTGCAGGGCAGCGAGCTCCGCGCTCTGGGATCGTTCCAGAGCGACAACACAATCGTGCAGAGCGCGAGAGCCATGGTCAACCATAG
GTGAACCATACAGAGGGTATTTTTCCACCCCCGCCCCCGCTGCTGCGTGACGCGCACGGCTCGACACGTTGGATTGTTTAGCTGGTAGTGGACTATGAAG
CCCCGAAGACGAGCCGAGATCAGACTCGTCTTCGTATTCGTTGGTGAAGATTTACTCCCCATCGAGATACAAGGGAGCCACGGGACGTCCCGGAAATGGT
GAGGTGTACGAGGCCCAGAATTGAGTGCAGGCATAATGCCTGAACTAGCGCTACGAGTGCCACCCGCACGGGGTGCATCACGGTGCTCAAGTTGAGCACG
AGGTCTTGCAGTGAAGCGGGTACACGCACAGAAGTGTACCCGAGATGTTCACTTTAATAAAGGCGCACTGTTCCGAAGCGGCAGTGCGAACACGATGCTT
CAGGTGGAACTGCGCAGGGAATTCCCTTCTCCATAGCGTCATTATGGAGGCGATCGATGAGATGACACCTCGAGAAGACCTCGAAGCGCTGGCGTGTTGC
GACAATACGCTCGCGGTAGCCTTTCGCATTGTTGCTGAAGTTCACACTTAATGCGTTCCAGGATTGACAAAGTGCCTTCCAGTCAGACACTTTGCTTTTG
CACGAAGTTTTCTTCGTCGGAGCTCATGGAAGAGCCCGATGTAGTAGCCACGCTTCTGATTCGTTAACGGATTAATGTTCATGTTGACGGCCTCAGCGTC
ATCATTGATGGCGCTGCACACGTACAGTCCTATCGGGTTCGGCTGTGATGTCGCGCCGAGCCTGTCAGCGATTTCAGATGCAGTTGGCATCCAAGGGGCG
CGTACTGCAGGTGCAGTACGCTGAGAAGAAGGCGACACCGACACAGGTGGCTGCGCCGCTTCTTTATTATGCGGACGCTTTGATCCTGGAGCGTCCGGAC
CATCGTCACGGCCCCGCCTCGACTCAACAGGGGGATATGCGCTGGTTCGGTCGACTTAGTGTCGACCGCTGAAGCCAAGCAGCCCTCGGCTTCCATGGGG
ACGTCTTCAATGGCTATGTCTCCGTCAGTAGACATAGCTGGCAAGCCCTCCATGACGACTGACGACCTGTCAGACGTAGCTTGTACGCACTTCTTCTTAT
GCAGGTATTGAGTGACAGAAAGGATGCTTTCTGTCCCGGGCGTGTTCGCTTGCGCGGACTCTGAAGTGAGTGTGCCTGCAGGTGCAGGCACAGACGTAGC
AGAGTCTGTCGGAGCGGTCTCTTGCGCGGACATCTTCCCTAACGAGACCATTGCGAAATGAGCTCGGGGTTCTCAAACGGTTTTACGGTCTCGTCAATAC
TCTGAATGATGTGTTACGACTTAAGGGCCTTAGCTTATCGGGGGTGGGTGGAGTAACGGGGCTACACGCAAGTGGCTACACATAACCACATGGTCACGAA
AGCGTTTTTCCACGTTGGTGTGAGATACACCAACTGTTACATCTAGCAGACTGTTGGTCTGCTACATGTATTCATTGGCTGAAAGACAGTATCTTCAACA
AGTTATAATAGTAGGATTCTGTCGACCATTCGTTGATGAATACCTTTTTTTTAGAATATTAGATTAGGATGAAACCCAAACAAACAAAAAAACCGTTTTC
ATTT