Description :
From Genome Similarity Track
Location :
Scaffold_1553:2097- 6316
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1553-fgenesh-gene-0.0U3 snoRNP-associated protein Utp7
Pytar_ATCC12531maker-par_contig_1553-fgenesh-gene-0.2Cullin family protein
Pytar_ATCC12531maker-par_contig_1553-snap-gene-0.5Tripartite motif protein

Sequence
4219 bases(100 bases per row)
GACTACGGCGCCTACACCGTGCGGTACACGCGCAATGGACGGAACTTGGTGCTCGGTGGCCAAAAGGGCCACTTGGCGACCATGGATATGTTGCGCATGC
GGCTCTCGTGCGAGTTCCAGGCCAACGATCTCGTGCGCGACGTCTCGTACCTGCACAACAACTCGATGTTTGCCGCGGCCCAGAAGAAGTTTGTCTACAT
TTACGACAGCTCGGGGGCCGAGGCCCACTGCCTGCGCTCGATTCCCGAGCCACGCAAGATGGAGTTTTTGCCGTACCACTTTTTGCTCGCGACCATCAGC
GGTAATGGCTTTCTCAGCTACCACGACGTCACGACAGGCAACGAGGTCGCGGGCCACCGCACAAAGCTTGGCGTGTGCGACGCCATGGCGCAGAACCCGT
GGAACGCCGTGATCAACTTGGGCCACGCCAACGGACTCGTGACGCTCTGGACGCCCAATATGCACGAAGCCGTCGTCAAGATGCAGTGCCACCAGGGCCC
CAGTACGTTTTGATCTCTTCCTGATCTCTTTGCTTTGGATCTAACTCACTCACTTTTGTGTAGTCCGCTCCATGGCCATTGACAATAGCGGCAAGTACCT
CGTGACGACCGGCGCGGACCGCAAGCTCAAGGTCTTTGACCTGCGCAAATACCAAGAGCTGAACGACTACTACCTGCACTCGGCGGCCAACGCCATGAGC
GTGAGTCAGCGTGGGCTCGTCGCCGTGGGCTTTGGGCCCAACGTCCATATTCTCAAGAACCCGTTCACAAGCCAGGCGCCGACGCCGTACATGACCCACC
AGATCCCGGGCACGCAGGTGAGCTCGCTGGCGTTCCAGCCATTTGAAGACGTGCTCAGCATCGGCCACGCGTCGGGTATCGCCAACATTGTAATCCCGGG
CGCCGGTGAGCCCAACTTCGACACGTTCGAGGCCAACCCGTACGAAAACGCCAAGCAGCGCGGCGAGACCGAGGTGCGGTCGCTGCTGGAGAAGCTGCGC
CCCGAGATGATCATGCTGGACCCTCGCGCCATTGGCCGCGTGGACCTCGACCCGGCCACGGAGCAGCTCACCAAGATCCAGCAAATGGAAAAAGCCAACG
GCAAGCCGCTCATCACCAAGAAGAAGATGCGCGGGCGCAACCGCCCGTCCCGTCGCCTTCGCAAGAAGCAGCAAAACGTCGTGGATCTGCAAAAGGAAAA
GTACAAGGACATGCTGGAGAACGCCAAGAAGAGAGAGGAGCGGCGCCAGCAGCAGGTCGAGTGGGAAGCCAAGGCGCAGAGTGCACCAACGGCTCTGAAC
CGGTTCTTCAAGAAATGACCGGTTTCCTGATGATACCAATAGAGATTTACGGCATGGTATTTGGTTTTGTTTCTTGTATTTTTGTTTCCAAATAGCCATG
ATGATCTGAAGAGCACCCAGATGCAAGCAGAAGAAAGTCGAATCGGGGAATGCAAAAGTCTACGCCAAGTAGCGGTACGTGTTGGCCTGCTCTGGATCGC
GCTCCAGGTACTCGCGATCAATGAGCGCTTCAATACGGCGCTTGATCACCTTGAGGTTGGGCTTGAAAAATTGCAGCTGTGTGAGCACCTCCGAAATGAG
CTGTTGGTGCTGCAATGTCTTACGGGCCTTCATGATACGCACGATCGCGGCCTCGATCGCGATACTACGGTCTTCCTCAACGTGCTTCTGGCTGTGGCTC
TCTTCCAGCGACGCCATGGGGATACGGATCTTGCGCATTGGCGATGCAAAAGTCTTGTTGATTTCGAACTGGTCGCTCGTCGAGATCGTCTTGCCCGCCG
GCAGCTTGTTGAGGATCTTAAACTTGCCGCACGACAGCGAGTGCATGATCCGCTTCACGACATCCACCGACAGGTTGAGCGACTCGCGCACCGTCTCAAA
CGAAAGCGCGCCTGCGGCTTCGTTGAAAAGCAAGAGCGCGACCGCCTGGAGCGTCGTGACTTGGAGATCGTACCACTTCTTTTTGGGAAAATTGGCGCGG
ACCGTGGCATTGCCGAGCGAGTGGATCCACTGAAGGCGACGGTGGCTGGTCTTCGAGTCGTAGTATACCTTGAACAGGTTCATGCACTTGACGAGCTGCG
GCGGCATTGTGATCTCCAGCACCTTGTACGAAGGCCAGTAGCCCGTGGTCAACACCTGCACGCTGAACTCCAGGTTCCCGCTGATCGCGACGGCCGACTC
TTGCTCGCGCTGCTTCTTAAGAAAGCCTTCAAACTCTTGGTGGTGGTCGCTGCCAATCGCGAGGTCGTTCATCATACCTTCCATCTTGCCTGTGAACTGA
GCACCACAGCGAAGCTTAAGCTTTCCGATCATCAGCACCTCGGCATCAGCCGACGCCGAGCGCTGGTTCAGCAGACGCTTGGCCAACTGGTTGCGGTAAA
TCTCGGCAAACAAATCCTTGTCGGTCAGGTACGAGAACACAAACACGACCTTCTCGAGGTAGTCCTCGACCTGCTCGTCGCTGAGCTTTTCACCGCCCGT
CTTGAGGATGCGATCACAGAACGTACTCATCAACTTGGCCGAGCTGTCGGGTCCCACATCCTTGTTGACAAATTCGACAAACGCTTCCTTCAGCGCCTTC
TGGAAGAGCGAGTTGCCCTGGAACTGCTCGTTCACGACGCTGCGGAACTTGTCGTGGATGGTCAAAATGCTCTTGATGTACTCGGGATCGGAGGCGGCGT
CCTTGATATTCCCTTCTGCGACCGCGTTCGCGCGCTTCTCAACAATGTCGTTGCCCACGGCCGTGATGTGCTTCTGCACCAAGTCAGCAATGGGGTCGAG
GCCGTTCTTAATGCGCGAAAAGAGGCGAAACATGCGTGCCAAGTCGTCGAGCTTGTCGTTGCGGAGCAGCGCAATCACGCCCGAGTTCTCGCGCTCAATC
AGCTCCTTCTCGGTGACCTGGAGCAGCACATCTTCCAGCACCTTACTGAGCTTGGGGTCCGTGATCTTGTTGAGGTATCGCTCGACACGGCTGCGCTCAC
TCTGGAGTGCCTCTTCGACCTTTTGGAGGTAAACGGGTGTCGAGTCCTCGGTGAGCCACGCCTTGGACTTGGCGCTGTAGTACTGGCGGCTCTGCTGGAG
CAGCTGGCTCTCAAAGTCGCTCTGGTACACGTCGAGCGACTTCATGCCCATGACCTCGTAAATCTCAATGCAGCTGCGCACGAGCGTCGTGTCAATGATC
TCGCCGTTGCGCTCCTTCTCCACGAGTTCGAGCACGGCCCACTTGAGACGGTTCTTGATCTTCAGGAAGATCACGCGGTCAAAGCTCTGGAGTCCGGCCT
CTTCGAGCGTCGGCAGCGAGTGGTGCTTGACGTAGTAGCGGTCGAGGTACATAAAGAAGCGCGACATCCACTTGTTCATGAGCTTGTGGTTCTCCCAGCG
CTTGACGAGCTCGCCCAAAAACACCTCGTCGTGAGCCTTCTCAAGGCTGGGCAGCACCTGGTTCTCGAGGTACGTGTCGAAGGTCGTGCCGTGGCGCTCG
TAGAGCTGCTGCGAGTAGTTGTACGGCGCGCGCTGCGTGCACATGTTGTAGCACGTCGTGTAGATGGGCATGAACGACTTGGGCGGGAACGGCGACTCGC
GCACCTTATCGAAGCCCTTCTCCAGGATGTCGAGCAGCACGTCGATGGCCTTGGGCTTGATCTCGACGTCCCATCCTTCCTCCAGCGAGATCATGCTCTT
GCTCATGGTCGGTGGCGTTGGCGTCGTTGGGGATTTGGTGGGGAAAAGAAAGATTGGGTTGGGCCCGGCGCCCGAGCCAAACTCAGAACACAAGGGGAGG
AAATGGCGTCGTGGGTTGAAAAAGAAGAAACCCACAATTGCGGACGGCCCACTGGGTTCGCTGGAGTGGAGAAATGCGCTAACGAAGGGGATCCTGCGAT
ATAGCATGGCGGAAATGAGTCATAACGATGTGAGAAAATCGTTGAATAGAGGGGTCACAGTACATCAGGCGTTTTCCCACCAACTTCCGCACATACCTCT
ACAAACGAATATGCAACGCTGATTGGTCCGTGGGAGGTTCTGCCTCCACGTTTGAAAAACCATCATGGCAGACCGACCCTGGCGCGGCGGAANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCGCGACCACAAGGAGAGCATGGGGCGACAGAGCAGCACGTCCCGCGCTTCCGAGAGATCGAACGGTGGCGCACGCAG
CAGTGCCTCTCCCGTCGCG