Description :
From Genome Similarity Track
Location :
Scaffold_113:2097- 3331
Transcript NameFunction/comments
Physo_142364hypothetical protein

Sequence
1234 bases(100 bases per row)
TCTGGGTCATCGTGCGGCACTCTGGGTTACAAGTCTGCTACATCACAGACTCGCGTGTATCTCCACAAATCCAAGCTTTTAGCGGGTTTAGCGGCCTCCT
GTGCATGATCATGGTGGTAGTGGGTTGATTCTCAGGGTAATTTGATCCTCTGGGGCACTCTGAGCCACAGCAAGATGATTTGTACTCTGGGATACATTCG
CCAGAGACACTTTCCGCCAGACTTTAGGCACTCATCGTAAGGGAAAGTCCGCGGCTGGACTGAGTGTTCTCTGAAATCCTGGGCGTGCACTCCCAGGATT
CACACTTCCAGCCAGTTGGGCCCATCTGTGGTCAGGCGCTGGATTCATCCCGAGAAATCACTTCTCTCCCACAGTCGCCATCCATGTCACACGGGTACAG
CCGCGCCGTACCCAAGTCATCCACCAATCAGCATCCGATATAAACTCCATGTCCAAAGGGTGACGGCACATCGTCGGCAATTTTCTGGGGACCGCCTCGT
GTCACTCCCGTCGATCGGCACATTCGTGCCGGTTACCACCGTGCCCTTGCCGTCGGCCGCTGTCACCAGTACCGTCGGGACGCCCGTCGTGCACGCCGTA
TCACCGTCCATTACCACAGTTGCTGGTCGCAGGGGAGTCCGTCGCATTGCCAAGCGCCGTGATCCCCCTACGTCACCCGATCCTCGTTTTCCTGTCGCTT
CCTTTCCTGTTCGCGTCGAGCGAGATACTCGTCGTTACGGGCGCGAACTTCGGCATCTGGACACTCGCGGGCGAAGTGCCCCAGTTGATTGCAGGCATAG
CACTTGAGTTCGCTGAACCGTCCTGGTGTCGGAGTCGCCTCGACCGTCTTCCTCGTAGCCTCCGTTGCTTTGACTTAACGCGTCGCAGCTTTCGATCGTC
TGGCTGCGAGCTTCACCTTCTTGAGAGGCGGCGGTGCTCGTGGAGCATCTGCTTCCTTACCGTCATCGCTCTCGTCGTAGTAGTCAGGGCCAGCCGTCAC
CACCATATTCACCTTCGCCTTCTGAGCCATCTTTGTCGTCGCCATGCGCTTGGCGGTCGTTGGGGCAGCTGCTGGTGCCGTACATTTTCGTGGTACGGGC
GCCCACATGTGCCCGTTCAAGACGCGTCCCTTCGGCGCCTCCCACAGGCCATGGTACTTGTTGTACTCGCCGCATGAGTTCGTGAAACACGCCAACTTCT
CTTCCTCCGCCACGTCCGTGGTGCCAACGCCCAG