Description :
From Genome Similarity Track
Location :
Scaffold_24:2097- 3186
Sequence
1089 bases(100 bases per row)
ACCGTCCGTCCGTCCCCGCACTCTTCGTCCGACACACTCACGCGCCCACTCACGGCCTCGACGATGTTGACCAACTTTCTCTCGCTCATCATGAAGGCAC
CGGCGGAGCCCGAGACGCGGCTCCCGCCCACGACGCTCACGTACTTGCTGCAAGAACACAAGGTGCCAGTCGAGACATTGATCGCGCGCCACGGCGCCGT
CGCGACCATCGCCAAGTCGCTGTTGGGCGTCGTGCCCAACACGGGCAAGTACTTTGAGATCTGGCCGCCGGCCAACAAGATGTACTACTTCATGGTGCCA
TCCTTCCTCAATTTGCCGGCCTTCATGTTTGGCTACGGCGCGCCCAAGGAGCTGATCTCGCTTGCGCTGTACACGTCGTCGTTGGCGGCGTGCTGTCCGT
ACTGCTCGTCTCACACGTGCACGTTTTCGGTGCGACGCGGTGTCGAAGTCGAGAAGCTCAGCGTTCAAGCGATCTGCGCGCGCCATGGCGCGACGAACGA
TTTGTACACGCCTGTGGAGAAGAGTGTCATGGATATGTCGGAGCTGCTCGCGACCTTCCCGTGCAAGGTCAGGAACAAGGATCGAGCTAATCTGCTTCAG
CATGCTGGGAACCCCGAGACCGCCGAAGCGATTGTTCTGGGCATGGCAATGATGGGGTACCTGAACAAATCAATGGACGCGCTGGGTATGCCCCTCGAGG
TCGAGACGTACCGCGAGACGCGCAATGTCATAGGTGAGACCTGGTCGCCAGGAGCAAGTGGACAACTCGTCGATCCAGACATCCACACTCCGGAGCCGGC
TCCTGCGATCGATTCATTCGCGACGTACTGGTCTATGGTCAAGCAAGGTCCAAGTGCAGCCAATTTTGAAAAGAAGGCGCTCTCAGGCATCCCCACTGAC
GCGGAGGGAGCGACAGCATTTCTCGAGGAGCGGTACGGTCATCGATTCCCAGTACTCAAGTCCATGTGCCTACCGCGCCCAATGGCTGCCGTCGCTGCAA
TGATCCACGAGTGTTTTAGCGTTGAGAAGAGCATCATCGGCATCAAGGCCAAGCTCGCCGTGGCGCAGATCTTTGCATCGATCACGGAA