Description :
From Genome Similarity Track
Location :
Scaffold_79:20967- 22927
Sequence
1960 bases(100 bases per row)
CGCCCGCTGATGGAACTTGCTCGATCACATCTACGCTTTCATCTGGCGGGTCTCCATCCACTGGTAAGCACATAGAGTTTCCTCCATCTCATTGGCGCCG
TCAATCTCAGTAGAGTCAGTCGTTTGGCCAGCTCGCGATCATCTAGCGTAACAAAAAACGTTTACATGCTCGCGACGTGTGGCCGGTGAAGATAATTTTC
CTACATAGATCGCGATCTTGGCCTGAGCCGCCGCGACGTTAAGGCGATGCATATATTCTAATGGGGTTACGTCCAATCGCTTCCGTGCGTGGTAATATTG
TCTGACCACTGACATACCCTGTCCCAAATACTGTACCGGAAAACAATTCAGAAACGGCTTCCATTCACGCCGTGTATATCGAATCAGCTGGCTGTACCAA
TTTCAAACAGGTATTGTAGGAAGATCGCCAACTACTACACTCATTGCTTCTTCCGGCGCTTGATCGCGTAGGAACGCCGACTTGACTTTACTGTCCCGTC
TTCTAGCCCGATCTTCATCTCTATCCTTGCCGCTAACTTCCTTGAACTCCGTCAACGACGACACACGTGTATCGCGTCGTCGGAATGGATATCTTCAGGA
TCGTATGTGTTAGGTCGACTGAGATGCGATCCAGCCAATCCCATCTCGATATCTGGAATACATACTTCTTGAACTCTTTCATGTTTCATTCTCTCACTTA
GGTAGACATCTTGACGGGCTTGCGCTCATAGTTCCTGTTGGAACCGTTCCATGGCCGCGTCGGAGTGGGACTGCAGATTTACTTGAAAATGTATTGCGCT
CACGCTAGCGCGTACAGCTGCCGATAGTGGTCCAGTCTTGATCTTCCCAACCCGATCTCAAATGTGCCGCCCCACTTGGACGTAAGGATATGCCCTGAAT
GCCGATGGAGTCGTCTAGATCAATTTCGGATTCAGCCGATGGATGCTGCGACGATCCCGTGTGGTATTCTCGCAGGATATCTGCAATAATAACTTCCGCT
TGATCCAAGTAGTCACATTAGCATGTAAGAAAAAAAACCTCATAAAGCAAGTGACACGCATGGATCACTTGACTCTGTTCACACTCCAACCTTTTTTACG
CATCGAATGCTCCCGCGACGAATCCAGCGTCCCGTAGCAGCTGAATAATTCCATCGATCCCTTCCAGTGTGTTCGACGCTACAGCTGGGGCTGGTACAGG
ACCCTGAAATGTGCCGATCAACTTAAGCTTCAATATCTGGTGCACGGGATCTCTCTATATCAAGTTCATGAGCGTCTTTCAGTAAAACTCCTTCGCCAGA
GCACGTCTAGTTGCCAACCTTATGTCTTCATATCGTGTTCTACAAACGTGATCGGTCCAATAGCCGATCTCGTGACGCGATCGTGTAGATCCTATCCTAG
TGCTTCTTTCTTCTTCACTCGTCTTGTATTCAGATTCATGGTCGTCAATATTGTTAGAGTGGTCCTGGGTGATAATTGTTCGGTCTACCCGAAGGATTTT
CACCCAGGAAATCGTGTTTTGCAGCACGATTCGCGGTGGTTTCCGGAGGGAACTCAGGAGAAGGTCAAAGTTTCTCTTCCAGGTCGACCGATCGATCTTT
CTCTATAATTTTCTTGTCATCAAAACAGACGAATAATTTTAAAAGATCGCCGGGTCATCAGACCCCAAACTCTGAAGATCCGGGGATCTTTTAAAATCAT
GCGGCCGTGGCGATTCCTCTGCCTCTGACGCCTACGTCCCAGGTTCTATCTTTACCTTCTCATTCTCACTAAGGATCACGATTAAATCCCGAGTCACCAG
AAGATCCGGGCACGCGCATCATTGTGGTGGAGTAGTATTTGCTCGTTTTCTGATGCAATCCCAACTCTCCACTGGCACCCAGACGACCGACTATCGGAGG
GGGTACTCCATATCCGACCTTGTGTACCCGTCGATAAGGCGCATTACACTCTTCTCGGTG