Description :
From Genome Similarity Track
Location :
contig_47:20965- 23632
Transcript NameFunction/comments
g7800.t1hypothetical protein

Sequence
2667 bases(100 bases per row)
GTACTTGTTGTGCTTGATCTGTTTGAAGCAGAAGCATTCGCGCTGCAGTTTTCGGAAGACTCGGGCGTGTTCATCCCAGTTTTCATGGTCACCCGACAAG
CTGAAGCTCTTGTTGTCGGTTCTTATGGCGATGAGGGGGCTGTATCGGAGCCGGATGAAGGCGATTCAAGTCGCCGACATCCTGGACTGTCCAAGAAGTG
CTTGATCACGTGTTGACATCGCCAACGACTTTGACCCCGCAACAGGCTAGCACTCCGCCGCGTCGACCTTCCATGCAGTCTATGGTGCCTTCGTTTTCGC
TGCAGCCACCACCACCTCTCATGGCTCGGTGTTTTTATCGTACGGATACAGCAGCGACAAGAGCCCGCGGAGCCTTCGCAAACGGCGCAGCGGCAGTGTT
GTTTGTGGCGAACGAAGCCTCGTCCGAGCCCTCGCAGGCAGTCCTTCGACGGTCGCTTGCGGCCGCCCTACCGACTCACAGCACGAAGAAGCACCAACTG
GTTGGGTTAATTCCTTACGAGCATGGTCAACGACTTCGAACCGCCTGCCGACTGACCAGTTGGAGGCCCCTCCACCAGCCTTACCAAAGTCGCTTATTCG
ACGCTGGACTCTGTCTGGAGCTTCATCAACGACCAGCGCCGCCGCCAGCTGCGAGCTGGTGGCCGATGTGCAGTTCGAACTGCATCCTGGAGGCACAACG
TACGCTTGGGGTGACGCTGAGAACGGACGACTGGGATTAGGAGAAGTGAAGGTGGAGACCACAGAAGGAGATGCTGGTGCTGCTGATGTAGCAACGGCTG
AACGCCTTTTGTTCCAGGACGGGTATGAAGCCCTCACAGATGCCACCTACAGCTTCGTAGCGCAGCCCACACACCTTCCAACACTTGCAGGAGTGGAAAT
GAGGCAACTTGCATCGGAAGCGCACACTCGTTGGCAGTGACCAAAAGCGGTAAGGTTTTCTCCTGGGGGCGAGGTGCGCGAGGACAGCTTGGCCAACATT
CAGCCAGATTTTCAAGCCCATCAAGCACTGCTACGACTCCAACAGATGAATGGACTCCTCGACTAGTGCGGGGGCTGCACTACGAGCGTGTGGCACAAGC
TGTAGCAACTGACCAGAGTTCTCTTTTTCTCTCAGAGATTGTGCCATCCTCCGTCTATGAGCAGCGCCGCCGCCAACTCACGCAACTCCGAGCGATAGCC
AAACAGACCAGGCGTGATAGTGTTCCTGCTACAGATGAGTAATGAACAACAAAGTTCCAGCCATTTGGGATATCACTCGTTTTGCGCTCCAGACGTTAGT
GCAGCAATTCGCGGAGACGTAGCACCAGATCCAGGCAGCGTGCGGACTGTTCCTCGATAGGATTCGGTTCCATTCCTACGGTACCCTGCACCAAAATGGA
GCGAGAGGTTCGACGTTCCAGTAGCTGTGCGAGTCGATCCTCTGTAGCGCTTCCTGCTCGTCCGACACTCACCCTCTTCTCAAGACGAGGCGGACTCATG
GAGCCCAACCGCGAAGCAGCTTTCGTATCACCCCCTACAGTATCCGGTTCTTGTGGCAGCAAGTACAGCTTGACTTCACGTAGCTCCCACGTCTCCCAGA
GCGGCGACGGTTGCGAGAGGTACACACACAAGCTGTCGAACACGTGCGGGTTCCAGCTCACGGGCAGCTCGTCAAGCTTGACGAGCTGCCAGTTCTGCGC
ATCGTCTTCGCAGTGCACGTGTTGCATGAGCGGGTAGGCGGCAGCCAGCTCTGTGCTTGATCCGTCGGCGTTCACTTGCACGATCCTCATCCAGGCCACG
TAGAAGTTGCGGAACACGAGGCAGCAACGATACGGCAGCTTGCGGGGTGTCAACAGGGACAACTTGAAGCCGACACTGCCCGTAGCATTGACGCTGGGGT
TCACGGACTTGGTAGCGGGCGGAAGCGAAGGTTGCGCTGGCAGGTGGGAGACCTGGATGGGAAGCTCCGTCATTTTTGCAAGCTGAAGTGGATGCTACAC
GCGAAGAGACGCGACGTTTCGTTGGACCAATCAGAAGGCGGTATTTGGAGAAAGTTATACATGGGTACGAAACGTGGCGCCTTGTAGCCATGTTACACAA
AGGCAATCTCAATCAAGATACTTCCGCCGCTTGATTCAAGCAGCTTGATAGAGTTACCTCACTGGTACGACAAGCAAAAAATATCGTGGTGCAGCGAGGT
ATCGAGCGGAAAAGTTGAGGGCGGTTTTGCAGCATCCACTCCGGTGCTCGACCCGGGTATGAGTTGACCAACCGTTGTTCGCAATACATGTGAGAAGCAA
CTGGGGGTGGGCGGGGTCCGCTCAGCCTGCCCGGTTCCTCTCCGTCTCACCAGCACATCCGGTTTGACGGTTATGACTTCTAGTAAGTGCAAGAGTTCTC
AGACGGTTGAATAAGGTGGAGAATCGCGAAGGTGAGGTGTTGCAAGGAGCCACGTGACAGACGAAAAACTTCAGGAGTTCCGGGCGCAATAATTGGTCGC
AGTCTGTCAAACACTGCAAGTGACGGCGAAAATCCCAAGAATACGTGCATCGAGGAGTACGACTTACTTTCGAGTCGAGATCGACCACACTTATCCTCCT
TATCGCCTGCATTTAGCTGCTCGGGGCCTATACACCAATTCGCTGTGAACTAAGCTCCATACACGCA