Description :
From Genome Similarity Track
Location :
Scaffold_33:209631- 214999
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010947Similar to DDB_G0290503: Putative leucine-rich repeat-containing protein DDB_G0290503 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G010946Similar to cdc7: Cell division control protein 7 (Schizosaccharomyces pombe)

Sequence
5368 bases(100 bases per row)
CAAAGTATCGAGAAAATCGTGCATCAGCTCGTCGAGACGGATTTCCCTACGCTCGCCACGAGGTTTGACACGACGATCCACGATTTTCGCAGTGAAATCG
AGCATAAATCCCGAGAACTCGCCAAGGATTTGTACAGATCGTTGGGCAGACTCCAAGAGAAGCAAGACACCTCTGAAATGACCCTCTCGCGACGCATGAA
TGCATTCATCGACCGCTTGTACCGCGATCTCTTGAGCATGACGAGAGCGCACCTTGTGTCCGTAGAGATGGTCAAGAGCGTGAGAACGACACTCGAATCG
TCGCCGCTGCAGAAGAATAACCAGAAAAAGAGTGCTCTGTTTGACGTCAGTCTCGAGATGCTTCAAACTGTGCTCACGAATTTCGAGAACGAGTGCAGAT
CGGCACAAGGCGATGGCGATAGCAGCGCAGCAGACACGTTTGGTGTCTTGTTGGAACGGTCGGTTAATTTCCAGGACGAACTCGAAAAGCTGAAAGAACA
ATCCAAAAAAGCCAAAGGCAGCGCAATTTCCGATAGCGAAAGCAGCACGAATAGCAGCTCGAGCTTTGTAGACCGTCTCGTTCTCTTGACGACCGCGCAG
CTCAAGTCTCTGGAATCCCTTCTTGTACACTCAGAGGCATCACAAGATGGCGATGACGAGAGCATGGCGATGACAACGGAAAACACCGACTACATGAACC
ATATCCGAGACCTTGTCGTACAGCTTCGTTCGATCTTGAGTTTGCTCTTCCTGCAGGCCGAGTTGCTGGATCCGCACCAAAAGCTTCATGCAATCGTTTT
AACCCAGAATGAGATGAACCACGAGATTAAAGCCCATAACTTTGCATTGAGTCAGCTTGGATCGATCGAGGCGACCGTCAAGATGATGAACTCGCGAGTG
AACTCGTTCCTCGAGATGTCGATCACGTTTGCCAAGGACGAAGACGTGAAGAAATCGATCCAAGAAATGCTCAACTCCTCGGACAGTGTTCGTGACAATC
TCGCGAGCCAGCTTGAATCGACGTATGCCGAGGCGCAAAAGAGAGACGAGATCCTCGAGCATGAACTCACGCAGCTCGTGAGTCGCGTCAACAAGAAACT
TGACAAAGACGAACTTCTTTGGACCCAGGAGATACTCGAACGACAACTGCAGAGCGTGGCGAAGAGCTCGCTTGGGGACGAGGACCTCGTCGATATTCAC
CGTCTGCTACGAAACAAGCTTGACAAGTCTTACTTCAACGCTTTGCTTCTCGAGCAGCAGAATCGGAATATGAACCAAAGCGGCGGAGCTGGGGGAAACG
CTGCAGAAGGATACGGGGTGCCCGGAAACGCGCCACTCATTGGCACCAAATGCATCTCGTGTAACAGCGAGCTGCCACCTACGAAAGCAATGATCAAAAG
CGTCGTCAAAGATGAAGTGCATCAAGAAGTAGCGAAGACGATGGCTCGTTCCCATGTGCAGCATCCGCAACCTGGAGTCGCGACGGCATCGTCATCGTTT
AACGTCTCGACTCATCGCAGCATGGAAAAACACAAACGAGACGTCATGCTCGCTGCACTGCAACAGAAAAATCAAATGAAGAAGTAGCACAACACTCACA
AACGCACGTATCATACCTCCTTTGGCGTCAAACGAGTTTCCTTCAATAAATAAATACCTTCGGTGGAGTAGTCCACTCATGTTGAACCGTAATCGCTCGC
TCGCTCTCCCTTAACTCCCCTCGACTCGACTAGAATACGGCAGCAGCAACGAGGATCGCTTGCAGTAGTTGCGACGCAATTTCCTTCACCAGAATCATAT
TGTTCTCGTCTTGCGCCAGCGCATAAATGATCGGATGAAGGTTGTACTCCACGAGGAACTGAGTGGGCGACGTATGCGATTCGAAGAGGCTCTTGAGCAT
TTTCAGCAGATTTTTCCGCACGATCGCTTTCGGCACGAGCTGCAAGCGCTTCAGGATCTCTGTCACGAACATGGCGCTTCGCCCCAGCGACTGGTTTAAA
CGAACCGATCGATTCGTCATCTCAATCAGCGGCTCCAAAAGGTTTTCAAGCTCCGTATCTTGAGCTGAACGGAAGCACATCATGAGTTTCATCAGATTCT
TTGGGATCAGCAGGACGTCCTCCACTTTCACCGTGTCATGAACCAGCCAGATACTGATCGATTTGATGGCGTCCATTTGCCAGTACTTATCGTCCAGCAT
CTCCAAGAAGAGCGAGACGCCATCGCAAGCCCACAAGTGTGCGCGGGCAGTGGGTGACGCGTGGGCCAAATCACATAGAATGGGGAGCGCGAACTGCTTC
AAAGGACTGGCATTCTTGATCACCTTCATCAGCGACGGGATCACTCCAGCCTGGGCGGCATGCGTTTGGCGGTTGCGATTGATTCGGCAGAGGTAAAACA
TCGATTGGAGCACGATATTTTCAACCTCCTTTCGCTTGGACCCGTGGGACGTCTTGGTTGAAATCTCTGCTTCCTGCTCGTTCAAAAGATGAACCAGCGT
AGGAATCGTGCCTGCACGATCTAACTTTTCCAGAGTGATTGGCTCCATGCTCAGGTTTCGAATGCACTTAAGGACTTTCACCATCGCAGAGACAAACTCG
TCTGACTGACGCACTTTTTGAATCGATGCTTGGTGCGCTGGACTCTCTTTTGCACTCGGCAATACTCGTCGGTGCAGTGCCTGCAGCAGCCCTTCGAGCA
CTAATCCGTCACAAACATGCTCCTTCACAACCGCATCACCCTGCGAGAACAGCATGAAGATGTCACACGTTTTGTGCAACTCGTCCATCGTCCACTTTTT
TGGTCTTCTCTGGATCGATCGGCTGCGATCTGCTGTTATGTCTATGTTCCTGCCGGCAAAGTCGTTACCCACTTCTTCAATGGCATCAGGAGCGCAAACC
GACTTCACAATCTCGTTGAACACCACGATGAACTTTTTCAGCAGTCCGGCCTTCACAAACAGCCGACAAATGTCGTTCTTCGGGATCGTCTGAAGGTTAA
ACACACTGAAAATCCCCTCGAGCGCGATTCTCAGCAAATCGATTTCGCTGTTTGTTGTCGGAATATCATTATCGAGCGTCAAGAAATCCACGAGCACTGG
CAGTCCGCCGCAGGCAATAAACATTTGCAGCGTCAATGAGCTTGTTTTGCAGCTTTGACGGACAAATTTGGCTGCTTCCAAGCGCACAAACGCCGCGAAA
TTCTGTGCGCTCGTCGAATCCATGGACAGATGTTCTTCCGAGAAAAGGGCAGAGGAATAATCCTGCTTTGTGAGTTTGATAATCACTGGAACGAGCCCGA
CGAGCGCCAGGTTTTCCTGGAACTTTTGATTATCTTCCACAATCTACGTCAGAAAACAAGAAGCACAAGGTTAGCAATCGCCCGACCAACTTCTGTTTCT
AGCCTCTCCTACGTACCATGTTAATAACCTTGAGTACAGCATAGAGGACATCCATTTTCTTCATCTCGAGTGCTTCCATTATATTGGGCACCACGCCAGG
CTGCGACATGAGATCCCTGCGAAGTGCTTGGTTGGACTCGAAAATCTCTTGCTGCACAGACATATCGACAGATTCATTGAGACAAGTAAAACGATACTCG
AGAAAAGAGAGCCAAGGAAGACTATAACGGGACTCACCAAACTCGTGCACGCATCTAAGATCACTTGGTCGTCCATGCTTGGATCCAAAAGTGCCAACAG
CTCAACGACGCGCGACGTCGCTTTCTGGTTGTTGTCTCGAATGGAAGAGTACTCGAAGTCCATTTCGTCGTCAAATAGATAATCTGGCAGACTCTCGGAT
GCGTCTCTGGCGCTGAGCATATCTCGCTTCGACAATCGATGCGGGAAATCTTGAGGAAAAGTCGAGTCAACCATGTCATCAAAGCCCGAATCGTCGTCGT
CGTCATCGTTGAATCTATTGAAATTGACTGAGGTCGTTTTCCCTTCGACGGATTTGTCAGCGATTGACATGGTCTTCTTTCGAGCCACCGCTTGAATCAG
TTGCTCTTCATCAAAATCCTCAAAACCGAGATCGCCTTCCTCGGTCTTTTCTGAAAAACTCTGCAACTTGGTCAAGCGTTTTTCCTTCGGCACAAGTGAC
GAGCGGTCCCATGATGTTGTTGAACCAGGGATGTCTGCATCTGGTACTATCTCGCTCTTAATTGGATTCGCTTTCTGGATAGTACTGCCTGACCGCGGCG
GTTTCAATGTATTCTGTGCGCGCAATTTCTCGTCCTCTGCGGTGTTGCCGTCGTCATCTTCCCACAGTTCGTCGTCAAACAACGCGTTTTCATCTTCTTT
GCTAAGCTGGAACACTTTTTTCAGCGCCGACACAGGCTCATCCATTTTATTTTTCGGTCGCTCCTGGCTTCCTACAGGGACCAACGACATGGGCTTTGGA
GTCGACTCGACGCCAAATTCATCGTCCCAGTTCTCAGCATCGTCGTCTTCTTCTTTAACCAATTCATTCTGGTCCCCAGGACTTGCTTCGACAAAGGATG
ACGACGTGTGCTTTTCCTTTTCGTACTTCTTGATCGTGTTGAGTACTGCGTCGCGATCGTTCAGCGAGGATACGTGTTCGGACACCATCTGCGAGCTTTG
CTCCACCTTGTTCTTCGGGATCTGCGCGATCCATGGATGCGTCAGCAGCTCTTCCGCCGACCCACGCAGACGTGGCTCCTTCATAAAACATTTCATGATA
AAATCGTGCAATGCCTACACACGCATACCACCACGACAGCGTCAACTAAACTCCAGAGTACGTCAACACGTAAGAGAACCACTACACTAGGCAATTTACC
GGCGAGATCCGCTCGGGGAGCGGTGGGTGGTCATCCTGCACGATCCGGAAGAGCGCTGCCATTGGCGCGAGGTCGAAGTACGGCGGTTTGGTCGACAAGA
GTTCAATGATCGTGCACCCGACGCTCCAGATGTCCGACGCAAAGGACCAGCCCGCCATCTCAATCACTTCTGGCGCCACTGTCAATAACCAAAACATGGG
CACACATGAGTCCGTTGTTGCGTCTGCTACTGGCAAAGTATATAATCAACACTCACTCCAGTAGGGTGAGCCGACAACGGAGTTGGACTTTTGGGTCTCG
CTGAGTTTGATCGCGACGCCGAAGTCCGCGAGTTTCACGAGTCCGTCCTTCGTCGTCAGGATGTTGGCGCCCTTGACGTCGCGATGCAACACGCCCTGTT
CGTGGAGGTACGCGAGTCCGCGCAGCACCTGCGTGATGTACATCGCGACGAGCGTCTCGGAAAATGATCCAAACTTTTTCATAAACTGCGCGAGCGAGCC
GTTCTCCATGTACTCGAGCACGATGTACAAGTACGTCTGCGTGCGGATCGTGTCGTGGTACTTGACGA