Description :
From Genome Similarity Track
Location :
scaffold_766:2096- 4095
Transcript NameFunction/comments
g10195.t1hypothetical protein

Sequence
1999 bases(100 bases per row)
GCGATAACGAGCTTGCACTCGTTAACCCCCTTAAGGTCCTTATAAGTTGCTAGCTTTCCCAAGGCTTTGAGAGCTTGTTCATTGTCACTGGCACTCTCAA
TAATCCGTTGAATAATGCGTTCATCCGTGATCGGGCATTCACTGGCGTCCCAGTTGTTCAGAAACTGAATAGGATCCAACGACATGAGGTCGTTTAGAAA
ACTGGAAGCCTTTTCCTCGAAGATATCGCTCAGACTCGGTAGAGCAAGGAGTAAACCTTTCAAAGTGCTAAACGTTAGGAGCTTCCGACCCAATTCGGGG
TCTGCCACCATCTTCATCAGAATTTGGAGCCCAAACGTATTAAGATCTTCGTCGTTGTCTTGAATGAACGCCAGTGATACGTCAACCGCATCATCTTGAT
CGATGCCCGAGCCCACTAAAGCTAGCAGCTTGAGCTTTGCCTCGTCCTTCACCTTACCGTCGCAACTCTTGTAAGCACCCAGTGCATCTTGATATTCCCG
CGAGACTTTGAGTTGACCCTTTCCGACTATTTTGACCTCCATCCGTGCAAGTGTCTCCGTTAACTCCTGGTGGTTCTTGTTCGAGTTCTGCGTCGTTTCT
TCGTGGTGTTCGTCCATTTTCCGACGCAGATCGTCGTGGCTCTGGACGATTGTCTGCAGGATCTCCACCGTGATCAGGAGCTTCACATGGTTCAGAGTTT
TCTCGAATTCGCTGTACTTGCTGGTAAACTTGTCGTTTTCCGCTGAACTCCCTGAACCAAAGGGATGCAGCACCATATCGCGTTTACGTGGCGGCTTCCA
CGCGTCGACAAAGGCCTTGAAGCTGTGAACCGCATCTTCAAGGGCTTGAATAGAAGGACTGGAGTGGCCGCGCTTGACCTCTTCGATCTTCTTCGCCAAC
GTAGCTAAACTCAGTTCCAGCTCCTTCACCTCGTCTTCGATCCGCTTCCTCTCTGCGAGGAAAGCGTCGATGCTTGTCAAAGCTTCAGACAGGAACTCAC
CGAAACCCGGAATCAGTTTGACGGCAAAGACAGCAGCCTTCGTTGCCATTGTACTGGATAATTGGAGAATGACTGAGTCTCCGCCCCCGGTCCACTTGGA
TATTGCTGCCTGCAAAATCCATTGGCACGATACCGCGCGACCGCGTCGCGGTCCAATTTGGAGCCAAACCAACTGATTCGTGAAAAGACGAAGTGTTTTA
ACAGTTTTACAATTTTAACAACATATATTCCATGTATAAACGCTTTTCGACAGAATTGCGCTGGTTCAATGCAATCACCAGGACTACGGCTTCAGGTAAA
CTTTGTTGCCGGAGCTGTTGAGATAGTACCTACCTCCGCGAGGACCAACGTGGTAGACTCGGCCTGGTGTGTCAACGCCGGAACCAAGCTTTTGGTTTGA
ACGGGGTGCTGGAGTCTTTGTTGCCTTACTTGCAGTCGAGCGTGTGTCTGGCTTGGCTGACGTGTTTACCTTTCTTGCCGAACTCTCCTTCATATCCCCA
TCGTTTGCTCTAGATCGGTGTACCACACCTTTGCTCGCAATCTCGTGAGGTCTGGCTGGAGGTGAAAGTCGGGCAGATAAGTCTACGGCTGGTGGGGGTT
TCTGCACACTTCTGCGCTTTGGGTCCTGCTTTTTGCTGGTGACACAGGGGCCTTTGGAGGTTGTCGCGTAGGAGACGGTGAGCGGAATCGGGACCGCGGT
GCTTCTTTACGCTTCGCGTCGGATTGCAGTTCACTTTTGTTCTTCACGCTTATCCAGAGCCTTTGCCCTCGCCTTCCAGCATCCAACCGATTGAACTGTT
CACGTAAGCTCGCGTACAAGTAGCGGCCGTTGGCTTCTATCATGTCGTTCTGAAAGCCCTCGTTCTGGGCGTGCTTGGCAATTTGGACAAGTCGGGCATG
CTCATCCTGGGTTAGACTCGGTTTGGCTGTTGCTTTGACATTAGTCAGCATCGCGTCAACCCTCTTGTGCAAACCCTGGTTGTTCGTTGCCAGCATGAG