Description :
From Genome Similarity Track
Location :
scaffold_199:20957- 31592
Transcript NameFunction/comments
Pl_107835hypothetical protein PHYSODRAFT_295319
Pl_107836HECT E3 ubiquitin ligase, putative

Sequence
10635 bases(100 bases per row)
CCAGCGCCCCCATGCCTGAATGGATGAAAAGACGGTTTGAACGGAAAGATGTCCTTCAATTCGTTGAGCCGTATTGGTCGACCAACTATGTTGTGTCAGG
TTCACGCCATAATGGTACCAATGGAAATGATCCTCGATCGTCAGCAAGCGCAGATCAAACCCTGCACCCTGCACGAGATGACATTACATTTTATGAACAA
TATGGTGCGTCATATGAAGAATGGATACTGATGTGGTGCCGACGATTAATTAATCTTTCCCAGCTGCCGGAGAGGAAGATTTTTTGGGCTTGCAAAACTG
CCCTCCCAACATGCCCACAAATATCGCGATTTCTTTTGCCATATCTGATACAAAATGTGCTACGGTCCGGAAAAACTGAAGTTGCTGAAGAACTTAAGAA
AGAAATCATGGCAGTTCTGATTGACCAAGATTGTGGGATGTTGATGGATGATTTTCTAATGGCCCCACCTGAATCAGAGCACACTAATGTCTCAATGCAC
AGTGCGGGTGGCACGTCCAATGAAGTAGGTGAGTACTTCCGTCGACATGACCAATGCTCCCAGACTATTTTCTCGACGATTGATGAACTAAACGAGTGGA
TTTGGACCAGCGAGAAGAAACGACTTGCGCTCAGTGGAAGCGCTGCAAGTCGTCAGACATCAGCGTCAGGTCGTAGTGATGTGGGCTCGGAAATCGATGA
TGATCATGAGAAGGAGTATCTTGAAGAGTTTTTAAAAGAGATACCCAGTCGATCACTTTCAAATGCGGCGTACCAAATTAAAGCGTACGCCCGAGCGATT
CAGTATTTTGAAGTCTCTCTACGTCAAGAAGAGTTCGAGGCGACAGAAGCAAGAGCCATCAGTATCGAGACGACTGGTCCCGTTCATCTTTCGTTAGTCG
CTAAAAATGCGACCTACCTACAGCAGCTTTATAAGAGCGTTGATGAACCGGACTCGCTGATCGGATTAGCTTCGTTGCGCCGGTTGTATGATGCATATCG
ACACAACGATACTGGAGCAGACCTGCAAGGTGATGTTAAAGAGGAGGGCCTAAACCTTGCGGATTTGATGCATCAGATTGTCGATCACAAGCAGCTTGCT
CAATGGGAAGACGCGCTTGCTTGTTATGAGCAAGCAATCCAAGAGATCCAATCTGCGTTGTCGTCCAAATCGTTACCGCTTTATGGTCAACTTGCAATAA
TGCAGCCCACTGTCCAGATTTTGGATGCGGACGCACACAAAGATCCTGACACGATCAAACCGGAGCTGTATTCTGGAATGATTGGTTGTCTTATTCAACT
TGGCCGCCTCGAAAGTGCTTTGCAACATATCAACGGCATTGTGACTCTAGAGCCTCAGTTTATGGCTGCGATGTATCCATATGCACTTGAGTGCTCCTGG
CGGCTATCTCGATGGGATCTACTGACAGATTTGCTGAGCGCTGAGAAACAAAGCCCGCTACTTCAGTCTTCAGGAAGCTGTACCGAAGACACGGCAAACG
CTCGACTGAAGGGTTTTGACGTATCACATCTGATGCTGGTTCGCGTACTGCATAGCTTACATGGTGGTCAACAAGAAGACTTCCAACGACACCTGAAAGC
AGCACGGCTGGAAGTGATGGGACCTCTTGCAGCGGCGTCTGCTGAGTCATACCAGCGCGCGTACCCGCTTCTTCACGACCTTCACTTTCTACATGAGGCA
GAGCAGGGATTCATATTTTTGCAGAAAGCGAAGGAGTGTGATGATCTTGATCGACGAAGTCTTCTTTGGGGAAAGCAGACCCCTTGGAAAGTGCGCTACG
ATGCTATGGCAACACAACTCAAGTACCGTGACCCGATTCTCGCACTTCGTCGAGTAATTTTACACGAAGCAGGTCTTCGAAATGAAGTATCGGAGAATTG
GTTGCTGTATGCCAAGTTGGCCAGAAAGGAAGGGTTTATTCGTACTGCCACCAGCGCGGTGATGCATGCTGAAGGTATGGACAACCAGTACGCATTGATA
GAAAAGGCAAAGCTGCTCGTGAGCCAAGACCGAATGTATGAGGCTTTGCAAATTCTTGAACCAGTTGATATTGACGCATCTACGTTGGATTATGATGTCG
ATGATCCTCACTTCTGCGCCAAGAACCTGCTATTGGCGACTAACTGGATGCAGGAGTCGGGCCAGCGTCAAGGTAAAAAGGTGATTGAGCGATATCAAGC
AGTCATTCATTTTGACCCGAAGTGGGAGAAAGGATATTTTTTCCTGGCTAAATACTATGAGTATCTGCTGAGCGTAAGCCACCCCGACGCGCTAAGTGGG
TCAATGAGCAGTGACGAAGCAGCTGCACTTCTGGTTGATTCGGTGTTTCATGCCCAGTTAATCAACTTGATGAATAACTACGTGCTCGCTCTAGCTCACG
GAACAAAGTTTGTTTTTCAGTCGCTTCCGCGGCTGTTGACACTATGGTTCGAGTTTGGCGAAGTACTATACGGCAGCACCAGTGGGCGAACAAGCAGCAA
GGCTAATAAGATCCTCCGGCAGATCGAGATCGGGCAGAGTCAGTCCACGAATGAACAGAACGTTCTTAATGATATCACCAAAATTGTGAATGAAGCCACC
GATACCTTGCCAGCGTACGAGTGGCTCGTGTGCTTCCCACAAGTCACATCACGAATTTGCCATCCCAACCCGGTCGTTGTTGATGGCGTCAAGAAGATCA
TGACTCGAGTGCTCCTGGCTTACCCATCGCAGGCGATGTGGTCATTGCTGGGTCTATCGCGATCACTGAATCCCCAAAGGCGAAATCGCGCGCGCGAAAT
TATCTCGAATACACAGCAGCAATTTTTGGCACAAGGCCTGAAAGAGATTGCAGACAGCTTCTCTGAGGGAATGAAAATGGCTGAAGAGCTCATCAGTCTT
GCCGCTCATGACCCTGGTAACAGTCAACGTAAGATCCATATTCGACTGAGCCGGATTCGGACCAGAATACTTGTCCCAGTTCAGGCTGCTCTGACAACGA
TCCTGCCGACTTCTGGGCGTGCCCCTCGCGATGAACATCACGTTGCCTTTTCGTCAAATGCGCAGGTTTACATCAAGGCTTTCAGTGACAAAGCCGATGT
CATGATGACCAAGGAGAAACCCAAGCGCATCGAAGTTCTGGGTACCGATGGACAGTTATATCCATTCTTGTGCAAGCGTGAAAAGACTGGTGACCTTCGC
AAGGACGCGCGTATGATGGAATTTAACTCGATGATTAACAAGCTGTTACAGAAGGACCGAGAAGGCCGCAAGCGTAAGCTCAGACTACGCACCTACGCTG
TGGTTTGTCTGAATGAAGAGAGCGGACTGATGGAGTGGGTGAGACATACAAAAGCCATGCGGCAACTTATCGGCCAAATCCACAAGACTGAGCGCGGGTA
CATACAACCTATTCGGCTGACGCATGACATCAAGGAGCGGTATCTGAACATGCAGAAGAAGTACGCTAACGATCCTTCAGCCATGGCTCGGTACTACCGA
CGAAAGGTGCTATCAATGCCAGTTTTCACACCAAGGTTTCACCAGTGGTTTTACAACAATTTTGCAGACCCCACGGCATGGTTTGAGGCTCGACTTATGT
TCTCACGGTCAGCGGCCGTGTGGTCCATGGTGGGTCACATCGTCGGCCTCGGCGATCGTCATGGAGAAAACATTTTGATCGACTGCATGAACGGCGAGTG
TGTGCACGTGGATTTCGACTGTCTATTCGATAAAGGGCTTAAGCTTACAAAACCCGAGATTGTGCCGTTCCGTTTAACGCCCAACATGATTGATGCCTTC
GGAATAACGGGGTACGAGGGTGTTTTCCGCCGAGTAAGTGAAGTTACGATGCAATTGCTTCGAGAGAACAAAGCGACACTGCGGAGCGTGCTAGAGTCCT
TCATCCACGACCCCTTGGTCGAGTGGGGTCGTCGCGGTAAGGCTTCACAAAGCAGCGGTAGCTCAAGTAAAACCATTGCCGAAATTTCAACTGAGCGTAC
CAAACATGAGACTCGACTTGTCCTCAAGACTATCGACGATCGACTGCGCGGCATCTACAACCTGGGTGATGCAATTCGCCCCCTAGTGTCGTCTTCTCAT
CGCAGCATCCTACCAGAGAACGAAACATTACCGCTCTCGGTGCAAGGGCAAGTCGACAAGCTCATCCATGAAGCCACATCGAATGAGAATCTCGCTCAAA
TGTACATCGGGTGGATGCCATTCTTGTAGGACTTCAAAGACGTTTAAATAACTTAAACAAGTAACCAAACCATATGGCTTCGCTCATTTTTCAACTGGAC
AAGATGGAGATCATTGCTGTGGGCACTGCGGCCATTGACGTTGTCCACGAAGTAGCCACATATCCGGGAGGTCTGTCGCACCAAGTTCTGTTGAAGATAC
AAGGTTCTAACGATTATTTCATGGTACAGAGGACTCCAAGGCACGATCATTAGCGACATACAAGTGTCGAGGTGGAAATGCAGCTAATGCATTGGTAAAT
GATCCAGAGTCGTTTAGGTATTGCGGTATAATGCATGATACAAGAAGACTAAATGTATTCCGTGTACAGGTGGTCTGCTCCCAACTTGGAGGTCGCTGCC
GATGGCTTAGCACATCGACTGACCCAGAAAAAGACAGCGACGCCGCGTTTATCCACGCCGATTTAGCTGCGTTCAATGTGGACTGCTCGTTGGCAGTCAT
TGAGAAGGAGGGTAGCATGCCTGTGTCGGTGAGTTTTTCATGACGGTAAATTGTTTGGTGTTTTACACTCTCATCTGTTGTTTGAGCGCAGTTCATTATT
GCAAGTCGAGGAACGGGATCGCGGACGATTGTGCACTCTCGCACCATTGCAGAATTGACTTGTGAAACATTTACGGTACAAGTAAAGCGGTACCTGAAGG
AGGTTTGCCATAATGTGAATGCACCCGTGTGGTTTCACTTCGAAGGACGCAACATGGAGGCTGTGAGAAAAATGATGATACACGTCCGAGAAAATGTACC
TCACGCGAAGATTTCGGTTGAGATTGAGTTTCCGAGATACCCATGGGGCCTTGCCAAAACGTATACAATTTTGCCTTATCAACAACGTTTTTTGGGAGAT
GTTAGCCTAATCTAACTGCTCTGATGAACGTATGTGTATTTATCTGTAGACTGGCATCGCTTGCAGACTATGTGTTCATGTCCAAAGATTATCTTCGTGA
CAACATTCATCTTACCAGTGCTAAGGATTTTTTCGAAGGTATTCTGGCGAAGCAATGGGGAGAGAACTGGAGTCAGTGGATTAAAACATTTATTTGTCCA
TGGGGTTCGGATGGCGTGTACTATCTCGAGATGACTAGCTCAACGGTTCATCACATCCCCGCTGCTCAGCTCGATCGCGTTGTTGAATCCAATGGGGCGG
GAGATTCTTTCATTGGAGCTACACTTGCAGGGTTATCTCGCGGTGATGTTCCCCTTCACCAAATTTTGAAAACAGCGTGTGATGTAGCGACTATCAAATG
CTCGCAGCATGGATTTAAGCTGCCCGCTGACAAGGTTTTGGTGTGGCAGCAGAGTTTGCAACGCTCAAAATGTACTGACAATGTAAACGGTAATTAATTT
CATGCTCACTAGTTGTGATCTTAAACCGCTAATCATGCTGTATGCCGGATATGTTTCAACTAGTTGAGGAAACGCCAGTTGGCACTCACTCAGTGGCGTC
GGAGGTTCAACTAGAGCTAGAGCGAGTGCAACCTAAAGACCCAACTGAAAGCGACGTAGTGCAAACATTTGCCGTGCCACTTCTTCCGGTACTCGAGGAG
GACAATGATGGCGATATTATTGTTCCTCGGAAGCAAACAGCAAGGTGGAGGAAGTCAGTCACACATCAGTTGGATGTGGTTATGGAAGCCGCAAACGAAA
GCAATAACAGGTCGATTGTTCAGTCTGAGGATATCATGCATGGCACAGATGCCATGTACGTCCTGGAGGCAAGCAGTCATACAACCTGGGATACTGCAGG
AACTCAACTTTGGCGAGCTGCATTTCTCTTGGCGGAATATATCTACAGCGCACCGGTTCGTTTCTTTTTATTACTGCACGAAAGACAAAGAGTTGTGACC
GTGACAATAATTTGTAGGAATACTTTGCCAATCAAACTATTCTCGAGCTTGGTTGTGGAATAGGTACGTACGTCTGTGGTTGAAAGCACGATCAGGTATC
CAGAAAATGTTGCTTATGAAGATATTTGATTCAGGTTTTACATCTATTGTGGCTTCACGAATGTGTCGCTGCGTATACGCGACTGACTCGGACAAAAACG
CTCTCTTCCTAGCAAAGAGGAATGTTGAACGCAATCGTTGCGTAAGTAGTGTTTGCGTAAGTACTCCAAGTTGATGAAATGACATAGGTGGTGGCATGCA
GGGAGATGTACGTCCACGCTTAATGGATTGGAACGACAGCAACTTAATATCAACCCCCGTTGATAAGTTTACTCCAGCAACTTCGTTAGACTGGAGCCGT
ACAGACCAAGCCGAGCTAAAAGACCTCACGATTATTATCGCCAGGTATGTTAAGATTTCGTGACTGCACAGCGAGCGCCTTGATTTTTAATGTTTCGATG
TGCTGGTGCTGTGTATCTACAGTGATGTATTTTATGATGATATCACGACGACCCTGTTCTTGCTTGCTCTTCGCCGCCTAATGCTGCAACACAATCGCGC
AAAAGCGTTCGTATCGGCAGAACGTCGTTTGGTTTTCTCCGCATCAGCTATGCGAGTAGTCTCGCTAGGCTACGATACCTTTCAAGGTCACGTTTGCTCG
CATGACCCGAGCACGTACCACACCCGTGTCTGCGAAAATCAAGTACAGTGTCGAATGTGCACATCTACTTCGGATGTGGGGAATGATGAGAGAGATCTAC
TTCGGTTTGTTGTTGACGAGCTTCGCATCAATGACTTTCCGCAGCGTTTCAAGTACGACAAGATGTCCACTCTAAAGCTCTGGAAGATCGATAGCGTTGT
TGTTCAGTGAGGTAAAAGATGAAAACACCTCGAGATCATAGTGTCAAACATTTATCCATTGTATTCTTGCGTTTTTTAGACTGGTGTGGATCTGCCGGAG
AAGGTTCGCACTAATGTGCTGCGAATACCACCAGCGAGACTTGATACACCCCATGACCGTGCTGAAGTGCCACTTCCTAAGTCTTGTCCGGTTGCGGTTG
AAGCAGCATTCAACCATGAACTCAGTATGGCATCTAGCCTCTTGAATCCACCTAGTGTCATGAGATCCAAGCGGTTGGTTGTGGCACTGGCGGGTTTCAA
GGCTGTAGTATCGCTCGCGTCGGTGTCAGTGCTCGAATCAGTGTAGGTGCTGCTACTACTTTGAGACCTCAAGTGCGTGTTGTATTCGATCTCAAGCTTG
AAGCTCCACGTTCGCAAATGCATGACTCCTGCCTCGAACGGGGCCGCTTGTAGCTCGTTTCTATTACTGCGCGCGAAGTTGCTGCGGCGAATATTTTATG
TTAGGGAGATACAAGAAAATTGCAACTGCACAGGCAGGGACTCACTCAATAGTGACAGTGATACACTGCTCAATAAGTCGAGGGAACAGGTCAAGGTATG
AAGCAGAAGGTTCTGCTAGCATGCGTTGGCCCATGGGCTCTAGTAATTGCTGCACAAGTCGCTCAACAAATTCTCTCTGCAAACGTAGACACAAGTGAGA
TTGATGCGAAAGAGAACTGCACGAACATCGGCCAACCTACCGCCGATATCCGCGTTCTGCCTCCATCTTTACTTGCTGTGGGAGTACACATGTGTTTTGC
AATCTGTACATCACCAGTGTGGAGCACAAAGTTGGCAAACTAAGAAGTGCGAAGATGAACGTGAATTCTTACCATCTCGACAACCTCCACGATGGTTTCA
GTCAAATCTGCAAGGTGCACCTTGAATTCTGCGTCGATATTTGTAAGCTCCATGGTAATGTGGTAAATTTGAGGGACGGAGTCTCGAGTAATTCGAGGCG
TGCACATAATTCCAGTGTCCATTGGATCCCGAGGTGTTGAAGTTACAGAGGAACAGGCCGACGAGCCTGAGGATGCTTGTGATGTAGTTTTCGGGGTCTT
CGACTGATGAGTAGTGCGCTTCGGATGAGCACTTTCATGATCCATCCCTTCGTTACTTTCGACAAGCCTTAAAATGTGCGCAGTTTGGAGCGAGGAGCGC
GTGAGCACATCATGCTGGGCTAGCATTGCCCATAGCACGGTGTCAGATTCACCTCTGTAGATGGTTCCGTCTGACGTTGTACTATGGTGTCGGACAGAAG
CAAAGTTACTTCCCCACAACTGTCGTGTCGCTTTTGTCCATGCCAGGTACTTCCGAAGTGTCGGTAGGAACATCGATAGGAGCATCACAAATGGACACGA
GCTTTTTGAATCAGATCGTGGTTCACCAGCTTCGACCAAGTCATCCAGCACTTGAAGGACTTGTCGTCCTGTTTTCAATATGTTTTCATCTATGTAGCCT
TCCTCAATTACACAAAGTAGGTGCTGATGAAGCTCTCCATAGAGTTGGGCACTCGTCCGAAAGAATGCCAAATCCACCGTTGGTCCACCTGAAAGATGAC
GATGAACCTCAGGTTGTTCAGCCTCCGCGTGAGGAACATTGTTGCCACTATCACCGCTCTGATACATTTCGATATTCTTCTTCCCATTCCTTTTCTTGCC
CTGCTTGGTCATTTTACAACGCTGCCGCAATGTCTTTCAGGCATGGAGAATCACCACTGCAATGACTGCCAGCTTAAAATAACAGCAATTCCATCCTGAA
ACCATCGGCATCATGAATAATTTCCAACGCTGTCACCACAACTTTATCCAGAATTCATCATCATTTACATACTTCACCACCTATGTATGCTTCTCTTCAC
TGTAGCACTCTGACGTAGCTACACTACTCGAAGCCAAAACCAGTGATTTCCATTTGGATCACCTATGCAATACAAAGACAACATCCGAACAATGAGACGT
TTGAACAGCCACCTGCAAGCTACGTACAGACTTACCAGAGATAGATATGATTTGAGATCCTCCTTGGTCTCGTACACTGGCAAATCGATGCGGTTAAAGC
ATGTATGTGCGCGGGGACACATTCCAAGCGGAGGCGTGCCAGTTGGCACCATTTGCAGTGTGAACGGGTGTACGATACCACTTGCGCTGGTGAGCGCCCT
GAAGCCTTCTACTGGTACGCGTGAGCAACCTGTTGCAAACTGCAGTAGTCGAGCACGCTGGTCGTCTGTAAAAGAGCCTACAACATCCCAAAACCACTGG
ATCACCTCAAGTTCCTGTTCAATTCCTTCTGAATCGTCATCCTGGGCTGCGTGTCGAACGCGCGAGTTGTTTTGCCAATCCGTGACGTTTAGTGTAGGTA
ATCCACTGAGGTAGAAGTCAAGCTCCTGATAGTCAAAGATCGTAAGCAACGACTTCGGGATAACCTCGTATAGCCCCTTGAGCAGCGCAGTGAGCTGGTC
AGACACGCTATCCAACATCCGGTAGCGTAGGACGAGCGATAAATACTCAGTCTTGTTCTCATCGGTCACATCAATATCCTCGCCACCAGGTTTCAGTTCC
ACCATCTCACCGGACGGTGTCTGAATGCTGAAAGTCACACACAACGCGTCCACGTGATCATTATCACGCACCCAACACAAGTGCTTATAAAGTTCCTCGT
CCAGAAATTCCAGATCGGAGAAAGTAATTGGGACGCCTAAGAGGTGCTTTAACAACGGGAGTGACATGCTTACTTCGAGCACGAGGCCATCCAGTATAGC
CTTGCCCAGAAGTCTTCCAGCAAAAGTGAAATACTGAAGATGATCTTGTCCTTCAGGTACACATTTCGCGGACTCTGAGTTGATCCAGTAGTTGGAGTCC
TCTGCGTGTGTTGTCACGAAAAGACCTCGGTCAGCGCTAAAAAGCTCCTTACACACAAGCCCAAACCATTCACGTAGTACTCCACCAGCGTCGAGCGCTG
GTTCCCCAATGAAGCCGATATTCAAATGTTCCTGCATCCTCGATTTGTCAACATCAGCGCCGGCCAGCTGCGGCAACGAATCGTCCAAGATAGAGCCACG
TCTCACATCAATCTTGAACATGGACTCTGTGTACGGCACGGCAAGATTTGTGATTTGCTTGAGGAACCATCGTTTTTTCTCTCTCCACGTCATTGCCAGC
ACACCTTCAAAGTCTACCAATGGTTCTCCATCTTCACCCTTGGGGTTCACATCCAGTGCTACCGAGTCTGTCTTCCTCCACGCCACTGCAGTCCCCGACG
CATTCAACTCCGAGAAGAATCCCATCGATGCCGCATTTTTCCGATGCAGTTGCTCTGCCAAATCTCCATGTAAATGATTCACCTGTGGGTTCTTGGACAA
GAACGAATTGCTTCTCAACTTATTCACAAATGAATCTGCGCGTGCAAACACAGACCCAGGTGCTGCAGCCTCCCTAGTCCTGACCCACACAAACCCTCCA
TTAGGTAGTGGCACTCGTTGCCACAATCTCCTTCTACTTGCTCCTCTCTGTTTCTGATTCAGTTGCATCTCATTCAACCTCCTGTACCGCAGTGCTCTCT
GTCTCATGCTCGTCATAGCCTCAAGTTCCTGTACA