Description :
From Genome Similarity Track
Location :
scaffold_180:2095- 3978
Transcript NameFunction/comments
Pl_108160hypothetical protein PHYSODRAFT_482112
Pl_108161fumarylacetoacetate (FAA) hydrolase, putative

Sequence
1883 bases(100 bases per row)
TTGCTGGGCATTTGCTACTATCGGTGCATTGGAAGCTGCTCATTGTATTGCCAACGGCGACAAGAAGGCGCCTTCTTACTCAGAGCAGCGGCTTGTAAGT
TGCGACACAAAGGACTACGGCTGCAACGGTGGCGCCCCCGTGTACGCGATGGAGTACGTTCGCGACAATGGCGTTTGTACGAGGAGCAGTTACCCGTACA
CTTCTGTGGACGGCGGCAACGCTGCAGCATGCACGAAGTCTTGCACTCCTACTAAGTCGGGCATCAAGGAAATTGTACAGCTGAAGTCTGGTGACGAGAC
CGCCCTCCTCAGCGCCTTGAAGAAGCAGCCGGTTATCGTCTCGGTAGTGTCTAACAACCCGGCCTGGAAACAGTACAAGAGCGGTGTCATCACGTCCTGC
AACACCGCGACGGTGGACCACGCCGTGCTGGCGGTTGGCTACGACGCCACCAGCATCAAAATTAAGAATTCGTGGGGCACAGACTGGGGTGAGGATGGCT
ACGTGCGCATCAGCCGTAGCACCCAGAACTTGGGCACGTGTGCCGTACTCACCGACATGTCCTACCCCAAAGTGTAACCTGCTAGCGGCCGTTAGTCTCT
AGTCTCTATCTGGAAAACAAATATACGTTTAATGTGCGTCAATCAAGTACAAGGCAACTTCAACTTGGCAAAAATCAAAACTACTGATCTCATTTCCTAC
TCAAAGCACTGACTTAAAAGGATAATGTACGGATAATTCTTTCGATTTAACCAATGAAAGTCCAGACTGTCTACCTGATCAATACATCCACTGCAGTTAT
CTCTAATCCATACTGAAATCAAGACAAACTGAACACAAATCTCACATAAAACTGACCGCAGTCAAGCCTCGACGACATAGCCTGAGCTTGGATCTGATGG
CATTGCTGCATCTCGTGCGCCTTCGCTCCAGTCCCCGCCTCGCCATGAGCCTCTCCCGTCGCTTCTCGTCACATCCTGACGCCAAGGCCACCGCTCTCAC
GCGCTTCGTGGACGAGAACGGCGCCATTCGCTGCGGCCAGCGCACGGATGACGGCTCCACTGCGTTGCTCGTGGAAGACGACGATCCCCTTGGCAGTCTA
CACTTTACGGGCGAGACTGCGACCATCGAGAAGGTGTTGGCGCCTGTGGTGCCGTCGCAGATCCTCGGCATTGGCCTGAACTACCGCAAACATGCCAAGG
AGACCAACATGCCGGAGCCCAAGTTCCCTGTGCTCTTTACCAAGGGAGTTAACGCCTTGCAGCACCCGCACGACCCTGTGGTGATCCCCCGCATTGCGTC
TGAACCCCCTGAGGTTGACTATGAGTGCGAACTCGCTGTTGTGCTGAAGGAAGCAGCTTGCAATGTGACCGAGGAGGAAGCTTTGACATATGTCGGTGGC
TACACCTGTGCGAATGACATCTCGGCACGTCGCTGGCAAGGCAAGAAGGGAGGAGGCCAGTGGTGTCGCGCTAAGACGTTTGACACCTTCTGTCCGCTGG
GGCCGGTGCTAATTACACCGGAAATCATCCCAGACCCCCAAACACTCGAGATTGCTACGTATCTGAACGGAGAGCAGGTGCAGAAGTCCAATACTGGCGA
CATGATCTTCTCGGTCGCGAAGCTGATCAGCCAACTCTCGCAGGACTGTACGTTGCCCAAGGGTACGCTTATTCTCACTGGAACTCCAGAGGTAAGATGC
AGTCACTTGTACTCTGCTTGAGTTGGAAGATATCTAATTTATCGTTGTGTGACTTATCGTGTAGGGTGTTGGTGTCGCTCGCAATCCTCCGCTATATCTT
GCTCCTGGCGACATGGTGGAGATCGAGATCGAGCGCATTGGCAAGCTTGTGAACCCCGTGGTTGGCGCCTCGGCGCTGTAAGT