Description :
From Genome Similarity Track
Location :
Scaffold_14:2094630- 2097577
Sequence
2947 bases(100 bases per row)
AGCGAGTTCGTATGGAATACGAACACGGGGCGGAGAACCAATCCAGGATCCGAAATCCGCCCATGCGTAACCTACGTGCTTCTGACACGCACATTGTGCG
TGCAGACTGACCCCATCTGGCGGATCCAGAGTGGGAGGCTCTCCAAAGACTGTCAACAGTCATTGGAGAGGCAGCCGTAGCGACAACGCTACGTACGCTG
TTGTCGACAGATAAACACAGTGCTGATCTGCGATTCGTCGTGCGCGAGCAGCGCGATGCTGCTGCTGCTACGAAAGTGTCTCCGGGACGACACCGCGCGT
GCAGACGTTGAAATTGCACGTGAGCAATTATGTGGGAAAAGAGGGCGAGCCGCTTCTCCAATGGCTTGTCGAGGTCGACACTGCCATAATGGCTCATCAG
TGATATGTTGCGTTCGCCACGTCATGTCTTAGTGGACGAGCGAGAAGCTGGCATATGTCCGCCGGCCCACAGATCATACGTGCTTTAGCACATATACGAA
ATTCAAGGAGGAGCTTAGAAAAGCGTTTGAGCCCCCTCAGAATGTGTTCCGGCCGAGAGCAGAGTTTCTCGACCTGCAGCAAGGTAAGCATGACGTTCAT
GCTTACGCCCAACGTGCGCGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACAAAAGTTGTTACGTTCATGAAGGGCTTGAAGAATG
GGTCGGTTAAGACCTATCTCTTCTTAGCGTACCCAAGTACTCTCGAGGCTGCGATTATTTTTGCGATGCAAGAGGAGTTTAACCTGAAGCAGACTAAGCT
GCACGCGAACGTGCCGAGGATGGCACGTCCGATGCTGAGAGCGGGAGCTCCAGAGCCTTTGGACCTCTCGAATGCTTCTGCTGTTGGACGCCAACAGCGT
ATTGGGGGACAAGTGCGGTGTTACCGTTGTGGGTACATCGGACACTTTGAGCGTGAGTGCAGAGCGCTTGTGCACTCGACCAGGGGCCAACGTGGCGATG
CCAGGCATCGCCCCGTACAATAAAAAAACGTGCAGAACCAGTAGGCGCGGGCGCCCAACTGGCATTGCAGTCGCGCGTATCTACAACGGACACGCGACAC
CGAGGACCACAGCCCCCAGTGAGAGGGATTCTCGCTACAAGAAGCAAGATGACAAGCCAAATGTTGTCGTCCTGAAAGTGACGTCGAAGAGAGAAGGCTA
TCTTCGCGCGTTGGTCGACTCAGGTGCATCTTACAATATTGTTCGACTGGACAGGCTCCCGAAGCTGATATTCTAGAAAATTAAAACACCTCGAAGTGTT
TTGGAGGTGCGGTTGGCAACGTGTGCCATCGTAAGAACGGATTCTCGTACAAACACGGGGTGTTTGTGGAGGATCTTATCGTCCTGGACCTGAACGGTTG
ACTTGGTATTGTGCATGCCGATGCTTGCACGGCATGACCCAGTGATCGACTGGGATAAGTGTACACTTGTACACTTCGGACGCAACGCGACGGAGAGCGA
TGGTCCTGTCAGTGTCGCGCATGCACCGCAAAGTGCAGCCGATCTAACCGTCAAGACAGCACCTTACGATGCAGCCTCCGGTGCCCAATCACAAGTCCTA
ATGGCTAAGGCAGTCGTTGAGGCTGTCTCAAATCGGAAATCAGATTTGAGACACGTTCCTTCTTCAATGCCCGTATCAACTCGGAATGTTGATAGATCAA
GTTTGGAAGAAATTCAAGTCACAGACAGTGAATGTGACACATCATATTTGCAAGGGAATCTAGCTACAAACAATAGCTGTGATGTCGGGCGTGTCAGCTC
CGGGAGTCGAAACGGTCGTGATTGGTTCGAAATATCAAAGGGCTCCACCAAAAGGTGGCGATGTGAAAAGGATGTATCGACTTCGGGAGTCGACACAAAC
TTGATATCAACATCGAGAGGGCACTCCGCCGAAAGGCGTCGAGGTGATGACAGCGCGTCAGCTCTAGGAGCTGATGCCGGTTGCAAACGTCTAACACTGA
AAACGCTTGCGTGCTCGCGTGCAGCCGGGCTGGACGACGAAGAGAGATGTAATCAAGCTGGGCTTAATCATTCGCGTCCGCAGAAGGATCCGCCGACGGC
TACAACGGAAATACGTCCAAGACCGGACCTGGACGAGAACTATGTGAAGACGGGCTTCACAAGAACAAGATGGCGCAAGCGACGAAAGCGGCGCAAGTCT
CGGTCCGGGACTGAGACGATACGAGCGATATCTGCTGGGAGATATTAGAGAAGACGTCGTGCGACGAGACGATAAACGTCTCTGACGCGGACCCGTACTG
GTCTCCAGTGCCGGTCAATGGAATTAGAGAATCCTCCGACGAGTGCGTCAGAGTTGACGTCGCTTTCAGTCATGGGCTGGGTGCGCTTCACGAAGGACCT
GCACGATGGACGCATCGAACAGTTATGCATCTTTTCGGATATCGAAAGGATGAAAAGCGAAGCGGAGGAGGTGAGGCAAGTCCACGCTGCGAGTGCCGCG
GAGAGTAAGGCACTCTCAGCACGAATACGAACAAGTACCGCTTCGACGAGCAGAGCTGGGACTCGTTGAAGTCGAGTCTCTTCTAAGATGTTCTGCTGGA
GCCCGAGGATTTGCTATAGAGATTCCTGCGGAACTTGCGCATAACAACAGTATACATCATGATATCGACCTCGTGCCGGGTACGAAGTACTGTGTGGCAC
GGCAGTGGCCATTGCCGCGAGATTAAGTAAAGGTAATCGACTTCTTTGAAATTCGTCAAAAGGCAGGTCAAGTGTGGGAATCAAAGTCCCCGTGCGCACC
GTTCATGCTTACAACAAGCCGAGCGATGCGGCGATACCGGCGCAGACGCCGATACCACGAAAAGATGATATCATCGATTCGATGGCCAAGCGCACCATCT
ATAGTGCTCTTGATCTGCGCGACGGGTTCTATCAGATCCTGATGCGT