Description :
From Genome Similarity Track
Location :
Scaffold_8:20945- 22004
Sequence
1059 bases(100 bases per row)
TTCTTTCGCGGAATGGAGGTAGAAAAGGAGTACATGCTGCTCGCTATGTCATCTCTATCGGTTTTGGCGAAAAGTGCGTGTCCACGAGGTAAGAATGCAA
CGCACCAATGCGCTCTGTGAGTCTTGTACTGGTTGCTGACGTTGGAAACGTTTTGGGAATGTATGCGATTGGTCTGTTTACTTGCAAACAGACCCCAGGG
TCCAGTCGACGGTGTCTTGGATTGGAACGAGCACATCGTGCTTCGCGTGAATTGTGCGGCACCGCCATTACTTCAGCTGGCGCTGCTAAGAGTAGTAGGC
AACAGAGAGGATAGCCATGCCGGCGAGGACGTTGCTAATGCAGCGACATCGTTAATAGACAAGCAAAGCTACCAGTGTGAACGCATCGGGCATGTGAGTC
TCCCGTTGTTTCCGAGTATCATCCAGGACATGCATTTGGTGCCGTTCAGCTTACCAATCGTCTCATCCTTACAAGACCAGCAAGGCAAGCAGCTCGAAAC
TCGAAAGTGTGGCTCCATTAACTTTGAGATTCAAGTTCTGGATCGCGACCCGGCCTCTTCTGTGCTACCGACAAACGAGGATATTGTGAAGTTGTCGCTT
CACCAGCTTCAAGGGCTTTATGGCAATAGCACTCTGCTCGATACGCTTTCCAGTACGGCTCACCTGCGAGTCCTGCTACTGCGTAGTGGTAGTCACTCTG
ATGGTTCTTCTTCCGACCGGAAAGATCAACTACAGCGTGAGACGTTGCTCCATGATGTTGCTGTGCACCTCCGTCCTGGTGCAGAGTCGAGTGAAGTGAA
CGAGACCATCGACATCTCGCAAGCCATCGGTAGCCTAGGAGACCAGAAACAAGGCGCCGTATTAGCGGTTCAAGTGTGCGACGTGGCACGAAATCCGCTC
GGGCAAACGCATATTCGAATCGGGAAAGACTGGAAAACGCGACTGCCGCAAAAACAGAAAGCGTGGTACCCACTCTACGCGAGTGAGTCCAACGAGGCGA
TAGCTCGAATTCAACTCAGTTTCTCACTGATTTCAAAGCAAGAAGCTAACAAGTCTGCG