Description :
From Genome Similarity Track
Location :
Scaffold_58:20940- 25639
Sequence
4699 bases(100 bases per row)
CTTTCTTGATCTTATATTTAGGCACCATAGCTTGCCAGAATCTATTTGTTTTGGACCCTGACCTGCGTTTCACGTCGGCTTTTTGGGCAGAGTTATTTTA
ACTATTGGGCAAGCGATTGCTTATGTCTACGGCAGCCCATCCAGAGACGGATAGGCAAACATAGCGCTTGAACAGAGTGCTTGAAGATGCCCTGCGCAGT
TATGCGACATCGTTTACGTCGTGGAGTTCATTTCACTCACGTGCTAAATTTTCAATCAACAATGCAGTTCATGCGTCAACAGGGTTAACACCATTTTTTG
TGAACAACGCGAGGCACCCTCGCATTCTAGCGCTTCTTGCTCTTTCAGCTTCAGAACACCCGGTTTCTAAGCTTTTTGGGAGAGTATCTGCCGATTGCAT
TACGCCGATATACTTGATGATTGTTTACGTTGAAGATAAGGTTGCTGCCGATGCAACCTATGCTGTTAATTTTGTGGCCAATGGCATATCGAGTCCCGAC
GCGATTCATCCTATCGCGTCTCCCGTTGCTTAATTTTGCTCCTTTAGAGTCCACTTCACCTGTAAGCTCGGCTGCTGTGACCGAATTCCTATTACTACGG
CAAGGCATCACGCGTTTTGTACGTGATGCCCTTCAAAAGCAGTGGAGAAACAAAAGAAGAAAGCTGACAAGATAGGTCGAAAGAACCCTTTTACGTTCAA
AGAAGGGGACAGAGTCTTGTTTTCGAGAAGTGGATTACCAGACACACCTGTGACGAACTTGGGCGCTAAAAAATTAGCGCCAGGATATATTGGTCTCTTT
CGGGTTGTTAAGGCACATGGAGATGCTTACACGCTAGACATACCTACCACTATACGTTTGCACTCGACGTTCTATGTAGGGCGCCTTAAGGATTACCTGC
CGGCGGATCTCCCTTCCTACCTTCCCCTCTCGCCTGTGCCGGCTCAAAGTCCGACATCACTTGTCGACGACGCTTACGAAGACTGGGACCAAGTCCTGCC
AGAGCGCTAGCAGACTCGTTCTTCTGGGGTCCTCCGAACGCAGCAGTCTCGAGTTGGCGAAGACGCTCGACCAATCCCTGTTGCTCTCAGCGAGTCCGCT
CGGCAGCCTCCGTTGCAGCTGCTGCACGATCACGAGCACTCTCGGCCATGTCACGGGCATCCAGTAGGCCGTTCATCGCCTCTTCAGTGTCGGCACGAAT
AAAACGCAGCTCGTCGTTCGGCGGCACAGGCGCCCAATCATGCGAATCGGCGCCCAACCCAAGAGACCTTCCGTCGTGATGTTACGCCTCCTTTAGTGGA
TGCATCGGGTGTGAGACGTTGGATTGTAGACCGTATCGTCGGTCATGATGATCCCACGCGTCATGCGCCAAGTAGTTACTCGGCGCTATAAAAGCGCCGT
GTTGATAAACACTATAAGGTCCGCTGGTTGGGATATCCACCGGCGGACGGCACGTGGGAGCCTCGAAGTATGCTGTCTAGCGATGTTCCTGACGTAGTCA
AGGAATATAAGTCCATTAAAAAAGGACGGCGAACGTGACCGAAGCCTTCGTTCCCACCAACGATCGCGCGAGCCGTGATGCTCTCGAGATGCCGAACGAC
GACTACCTCTCGAGCGACTCCGAGATCTATTACGAGGTTGGGAGCACCTGGATAATATCGCGGTCGAGCGAGACTGCGTATACACCCACGACGGTCGTAG
GTCAGTCGATCGTGACTGCGGAAATATCCCCTGCGACCGACATGTCGCTCCCTCATTCGGCGTAGCACAGATAATTGGAGCTCTGAGATGCTCCTCTCAC
AGCGGCCGATCCATGCTCGGATTTCTGGGGCATTCCCCGTTAATACACCAAGTCGTCCCATTATTGATGGATTGGTCGCGGTCTTTCCACGTTACACCTC
AGGCACCCCTCGTGCACATGGATGTAGCATATGTGTAGCTCGTCACGAGTCATGCGACATATGCGCCGGCATAAATAGCCAATAGCGTGCGAACCGTGTG
TATCCTCGCGCTGTTCGATTCAGGACGTGAAGAAGGTTCCTTCATGTCGACTCGCGTTCCAGCGTCTGAAGAAGGCGCACCAAGATCGTTGTGGCGCGTC
GTCAGTGTATGCATGGTTCGTCGCTTTGCCTCGCACGGTATGATACCGTGTGAAGAGGTCCTTCATGGACTCGAGTGACCTAGGTTCGTCAGCACCTTAA
AGGCTGTATAAGCCCCACGGCTTCAAGTCTTCGTCCATGACTTGCGGCCCCTGCTTTCTGCGGATCGACGCCTGATGGTCCCAGCTGTTGCTTGGGATCT
CGACGCGTGAGTGGCCAAGATTCATGCCGCTCAGCTGTGTGTTACTGAGCAGGTCCGAAAACTAAGAAGACATGCCGCTGAAATTCTCGATCGACTTCAC
GTTGGAATAATCGTTGAGCAGAAACTTTCTGCGTATGGCGCTTACGTTGTGGTAAACGCAACTTAAAGAGGGTGATAATGTAATGGGGCAACCTTTTACA
TTAGCTGACATAGATTTGAATACATAATTACATAAGTAGGTGTAAAGCAGTATCTGATTAGCGGATACTGCGCGTCTATTTATTGTTGGTTTTTTATTGG
GGTGCCAGACCCAACAGTTAGCCAATAATAATCAGATCTATATTCGGGTGGATTCCATGAGTTAGGGAACATATTTGCACTCAGGCGAATTAAAATAAAA
AAAAATAATAGACAGATTTAATTTACGTGTTAATTAAGAGCGCTTCCTCCCGCCCTTTACGGTATACGACGGTAACGGGGCTCTTACCCCGTTACAGCTA
GCTTACGGCTGCTACGTCGAGAATATTTATTTATCCACTCATCGACAGACATGTTATTTCGTTCGATGCATAGCCGGCGTCTTTGTATGCAGGGAACCTC
TCCCTCTTGCCTGGTGGCATGTGTAGGTTTAAAGCAGAGTTTCCATCCAGTTTGCGTGCAGTGCAATTTGCGATCTTCATGTTGCTCCTCTTCGGCGCAT
GTTTCTTTAGAGTTGCGCGGTGCGCTGCGAATGCAATGTCGGGTTGCATGCAACACGCAATCCAGAGCAAACTTCCATCAAGTAACAGGAAGCTGTTGAC
AGTTGACAATTATGACGTTGCAGATCCCTTTGTCGGTAGTCATTCGTCTCCTCCGAGCTTCGCTCTCATTAAATTTTGTCTGCCACTGGTAGGCGCACCG
AGTTGGCTTTGCTAAGTCCGTGATTGGGAAATCCATCGGTAGTTGTGACCTCTTGGCCTATCATGTAGCCATCAGAGGCGAAGGCTATAACTAACTCGCA
TGGTAAGGAAGTGCTTATCCGAGCCAAGATCTTTGCGATCGAGAGCGGACATTGCCTGGTCGACCTCATCTACTGCTTTGTGACTGTGTCAATGAAGAGT
AGGTTATCGGCATATGTGACGACATGTGTTGTGACATCTATGCAGATCTTGAAGCACATTAAGGTATCGGTGATACACTGGACGTATCCAGCAGCTGCGA
GTTTCTAATGCAAACTTTTACCCAAGACAGCCTGTCTGCTAGAGACACATCACAAGGCACAATGCTAGCTAACTTGAGCTTTTAAAGACGATATTTTCAA
AATCCGACGTCGTGAAGTCCATGACTGATAGGACGAGATAATGTGTCTCGTATCCGTCGTCTTTACGAGCCTTCAGATAGGAGCTGGGTACGTTAAAGAG
CTGTGATGAAGCGGTTTGAGGAAATTTGAGGTGATCGATGGGTGGATTGATCCAAAACGACGACTGATCGTCGAGGAGGATTGATTGGATGTTACGCTGC
ACACTTTTGAGATCGAATATGAAGAAACCAAGATCAATTATCAAGAGACCAGGATCGAGAATATATAGGTTGATCAAAGTTGAGAATATGATCGGAGATC
GAGGGTGATCGACGAGCGATTACGGTGATCTTCGAACAAGGTAATCACCGATCAAGGTTGACGACGATCAATCAAGGTAATCGACGATCGATCAGGAGTG
GACCACATATGCGAAGGAACGATCAACGAAATTCAGAAGAAACATGGCAGCATACCCTGGTATACAGACAGGCGCAGTGGTGATTTTAGCTTTGGATGGT
TAACATTAAACAGAGTTCTATTCGCTTCTAAGTACACGTGTCGACTTCTCTTCCGGGCTGGATATTTGGCCTCTTGACGTCAAGAGAGTCTCACATACTG
AAATCAAGTGATATCCCCAGATAATTGGCTGGGGATCAAGAATTTATAAGACAACCCCAACTGCGATTGGGTCCAGCAAGAACGTAACAGACTATGTACA
AGATCGCGAGTCGGACCAAGTGGTCAGAAGGCTCGCGTTTCAAGCATCTACATATTGGAAAAGGCTATCTCGTTGAAATCTGGGTGACTTACATCAAGTA
CCCTACCAGTACACCAGTACACCCGTGATCGTGTGAATATTTCCGCACGATCACACAAACCCACCCCCAACACGGTCAAGTTTTCCCTCGACACGAGTCC
ACCGAGAAGAATGCAACCCACCCTACCGACGGGTACACAAGATGAGAAAGGAATACATCTACACGGTATCGGAGTACCCCCTCCGTTACTCGGTCGTCTC
GGCGCCAGTGGAGAGTGGGCATCGCCTCATAAATGAGCGATCGACTCTCCACCATGGAGCTGTGCTAGCAAACACAAGGGTATTGCTAAGACCAGGATC