Description :
From Genome Similarity Track
Location :
Scaffold_74:209397- 210528
Transcript NameFunction/comments
Hyaar_Emoy28081363hydroxyisobutyrate dehydrogenase putative

Sequence
1131 bases(100 bases per row)
ACGAGCCAATGCCATTGAGCTGCTCAAGTGCGAGCATCAGCGAGTGCGTCCCCAAGCGGCCGTGGCCTTGAGCCTTCACAGCCACGTACAGCTGGTTGGC
AAGTGCGAGGCCAGGAAGAGCGAGGTTCATGCTGCCCAAAACATAAGGTACAAGAACACATGAAGCACGTCAGCCAATACAAACTCCAAGTAGTGCACCC
ACTCCAAGACGCTACCGTGTCCTGTGTCGTACCTCTCGGCCTCTTTCATTGCGATACCCATGTCCTTGACGAAGTGCTCGACGAAGAAGCCAGGATCGAA
GTTCCGCTCGGCAATTCGCGGTCCCAGATTGCTGATCGACCACGAGCCTGCAGCTCCTGCGCTCACAGCGCGGATGACCTCGTCCGCGTCCAAGCCGCTC
TTCTGCGCATAGAGAAGACCCTCGACGACGCCAATCATGTTCGTGGCGATCAGGATTTGGTTGACCATTTTGGTGTGCTGGCCAGCACCGGCTCCGCCCA
TGTGGCAGATGTTCTTGCCCATGAGTTCAAACAGCGGCCGCGTGGACTCGACGGTGGCAGAGTCCCCACCGACCATGATGGACAGTGTGGCCTCACGTGC
ACCGACGTCGCCACCAGAGACAGGAGCGTCCAAACTCGAGACGCCCTTGAGCTTTGCAGTCTCGTAGATCTCCTTGGCCAAGGACGGTTCACTCGTGGTC
ATGTCAACAATGACACCGCCTGCCTTAATCGAAGACAAAACGCCTCGTTCCGGGTCCAAGAACACCTTGCGGACGTCGCTTGGATAGCCCACGATACCAA
ATACAATGTCTAGCACAGCCACAAGCAGGCTGATGATCATTGAGTAGCAGCAAGTTGCTGCCTGGTACAAGTACCTACGTACCAGATACCTTGGCCACCT
CGGCGGGGGAGCTGGCAACCTGGGCGCCTTCCTTGATCAGCTGCTTGCACTTGGAGGGTGTGCGGTTGAACACCGTTACGTCATAGCCTTTTCTCTAATC
TCCCAGTCCACGTACCAGTAAAGAGCTTTAGTCCTATACGATGTTATACATCGAAGTAGATACGGGACAACCTACCAGGATGTGCCCGACCATGCTGGCA
CCCATGACGCCCGTCCCGATCCATCCAACTC