Description :
From Genome Similarity Track
Location :
Scaffold_100:209327- 213251
Sequence
3924 bases(100 bases per row)
ACTCATCACGTACTGACCACGAGGTCACTACGTATGATGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAACGAGGATGCTCTTAC
TACCCATGTCACTGATCTTGCCACAGTGCGCTCCAAGCGCACTACAGCCAAAAGACATCGAGTCAGCAGTTGAATTCATACTGGCTCGCGAAACGGTTGT
CCGTTTCATGCAAGATTCCATTGCAGAAGCAGTAGACTGACAAAAGAAAAACGCAGACAAGAATGGAAGGGCAAACGTTCTTTCATTCAATGAAGGTGAC
CTAGTCCTAATATCTACGGTAAACTTACCTCGACACATCGTGACTAACGTGGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGC
GCCGCATAGGCAACGCACAGATGCGCACGCGTCCTAAGTTCTACGTCTGTCGCCTTAGGCCGTATCGCCAGTATGAGTCTTATTCTGGTGAAGAAATCCA
TTGCGCTCAAGCATCTCCAAGAGATACTTGTGCTCGAGGTGCTGACTATCAGCCCGAGTCTGTAGCTCGGATATCTATCGGCTTCGACTAGCTCGTCGCG
AAGAGAACGCTGTGACCGCTCGTTTTCAAACTGATCAAACGCAAAATCTGATCGATCTCTCTCCCGTTCCGAGGAGAGACGTGTCACATTGTCGACCAGA
TCCAAACGACTACTCCTCTTGTGCTCGAGGTCCTCGTGAAACTCACACGTTACGCGCTCGAGCTGGCTCACAGTATCAGATTGAACCTGCAAACCCGTCT
GAGAACGTGTTTCCTCCTCCGCCTCATCCATTGATTGATGCGCGCGGTGTCCAAAGTTTCCTCGTGGAACACTTGTTGAACCACCGCGATGAGAAGGGAC
GTCGGACGAGTTACCTCGTCGGGTGGCGCGGGTATCCACCCTCGGCAGATAGTTGGGAGCCTCGCTCTCAACTGCTGGTTGATGTTTTGGGCCTTGTCGA
GCAGTATGACAAGGCGCATCCTATGCCGAAGAAGGCCCATTGAGGAACGAACGCCTAGCGCGCTTGTAGAGGGATTGAAAATTAGCTATTTCCTCGTTTA
TCTCTTGAGCGACACGTACCCTCCACCACGGGTCAGTCATCGATTAGGCTTCCTTTGGAGCCCATGCCAAGTTATTCACACAGCTTTGGCACGCATTACC
CCAAGAGAGGCATGGTAGCCCGGCCTCTCTTGACAACCGATGCAGTTTGAAACGTGGACCGGTAGAGGTCCATTTCTCAAAACATTTTCGAGCTAGCAAC
AGCTTGTCTAGCCAGGCATCACGCCCAATCTCACCAACGTTGTGGATGAAAGCGTTCCATGCCTGAATCAAAGAGGGACTATCACGTTTGTGATTCCCAC
TGTACCATCGATGCTTGAAGATCGCATCGATGAAGAAATCATCATCAGTGCGAAAGTTACTCGCACTAGGATCAAGCTTATAAAGCTTTGATGAATCGAA
CAATCTTATTCGATAACGATCACTCGTCGTGTCAGACAGACGAGACAACACTCTCTGAGGAGGTAGCCACGGCTTCTTCTCAGGAGCAAGGCGCAAGATG
TTACGATCCACAGTCTCTTGACTGGTGTCAATAGAAGTACCGACACCAGGATCATCCCGATCACTCGGACTATGATGCATGATTGCATCACAGTCAAGAT
CGTTCCGGTGGCCAAAGCCATAGCCTTTCTCGCTCTCAGCCGAACGACTCCGTCTCAGAGATGGAGGGTCTGAATCGTCGGACGATCCGAAGATGTCACG
ACTATCTGCAAAGATTAAAGTGCTTCGGGAAGCCGAATTAGTCGGCTTCGGTTTAGCCACCTCTGGCTCTTCCTTGGCTTTCGCCTCCTTCGAGTCGGTC
TCACCGTCAGACTCGCCAGAGTATGTGAGCTCAAGCTCATAATCTCCGATGTCACGCGGTGCATCACCACGTGCGTCTGCAGCAGACGAACTTACGTCAG
CTGCTTCGGGTGATCCTGTCTCCCCTGCGGCAGCAGAGTGGAGTCCCATGGCTGCGTTCTCAGCATCTTTAGCTGCACACCGCATGAACTTGTTAACGTT
GCGATGAGAATGAAGAATGGATGGATTGGCCAACAAGTGCTTCCTGTCCCAGAGCCACACAAACGAGTCATTCAATAGTCAATCAGTCACTAATGTGACT
GATGGTTAAGGGGGGGTGATGTAACGGGGTGCCTCCGTTACTTGATAATTTACATAAGGTAAATATCAAATATGAATATTGCGTTAGGACAAACACAATA
TTCTCACAATATTATCCTAATAGATAATATTGCCCCGCAGATGTAACACACTGCTCATTGGTCAATATAGGATTAAGATATCAACCAATAAAATCTAGCT
GCGACAGAAGCACGCAATGAGTGGCGCGCAGATAGTTATAATACATGTTTGTATTTAGACATAGTTAGATGAAGTCAAATAGGGATTTATTACAAGGATT
AACTATACTAAATACAGTTCTACTTTTTACCTTTACTGAGTACTCTGACTCCGTATCGCAATCTTCCTCTGCACGTACGTGTACGTGAGGTAGTCGGAAG
CACACACCGTTGCACTGTCAGCAGTGCAAGGTTTATTCAGTTACTTGAAATAAGGTGTGCTCCGTTACACCCACAACTTAATGCGACAATCATCACAGAC
GTTGCGCATAGTTACACGCATGATAATCCAGCAGGCAAAACGACCAACATCTTGATTAGTAAACGGCGACCGTGACGTTGTTCTCGCTACATAATATCTC
GCCATTTCAGAACTGCATCTTTTCTGCGTTCTCTGCATCGCTCCACCCATGACCATCAGATCGCCATCTACACCGATAACTCCATGTGGGCCACATCTCC
GTCGACTTTCAAAACGTTCTTTGAACTCTTACATAGAACGTTTTGAAAGTAGACGGGGCGTAAAGCTTCCAGTAGCTCCTAACGACAACGCCACAATAGG
ACATCACTGTAACGGAGCACTGATTGCTTGTACTGCCACGGTACAAGCTGCTTCCTCTGAACACAGGGTAAGCACATGCCTCGGAATCTCGCGTACACGT
ATCGTGCAGAGAAGGTTATAATACGAGATAAGGGTAAAAGTAGAACTGTATTTATTATAATTAATCTCCTGTTAATAAATCCTATTTAGTCTTTTTTAAC
TATGTCTGAATAGAAACATGTATTGTAATTGTTTGCTCACCACTCACCACTCATGGCGTTCTTCTGTCGTGGCTTGGCTTTATTGGTTGATATCATCGTC
AAATATCAACCAATGAACAGTGTATTACTTCTGCATCACAATATTACCTGTTAATTTAATATTGTGAGAATATGATGACTGTCTTAACATAATCTTCATA
CTTGATATTCACTTGATGTAAAATACCATGTAACGGACTCACCCCGCTACAGTGTGGTATGCTGAAAGATGCATCCGAGCCTGGCAGCACGGCAGCTTGA
GAAAAGCGCAGAGAAAATGAGTGTGATGTCGGATCATCATGATCGAATGGTGTCGAGATCATTAGCGTTGCAGCCTTAATTTAATTGCTGAATGAATTGG
AATAGAAAGATCGTTACGTGACGAAACAGCAGCTTACAGCAGTTGGTGTCCAGGTGTTCTCCCATTTTTCTCCGGAAAGTATACGTTCATCAAGTCCTGT
AAATGGTCTGACGTGTGATAGAGCCGAAGTCATGAACTATGTGGTTTGACGCCTATTCTGTTTATTCCCTCTCCTCATCTCAGGGTGGATGGACAATAGG
ATCTTCTACTAAGTTGTTCCGGGACAATTATCCAGTAATAGCGGCACATGGTCTGTGAGTTATTTACGCAATAGTCGTGAGATTTCTATCCAGACAGATA
TTCTAACCAGTACAGGATCTCTCC