Description :
From Genome Similarity Track
Location :
Scaffold_52:2093- 8067
Transcript NameFunction/comments
g18209.t1hypothetical protein
g18210.t1hypothetical protein
g18211.t1OWZ13356.1 hypothetical protein PHMEG_00013336 [Phytophthora megakarya

Sequence
5974 bases(100 bases per row)
AGGTGATGCAGGGTGAAGTCGAACTGAGCAAAGAAGGTCAAGAAGCGTGCAAGCTTCGAAGAAACCTTCGGGTGGTGTAACAACCACTGACATGCACTGT
TGTCCGTGTAGATGTCGAAATGACGACCATAGAGGTAATGACGCCATTTTTCCAGCGACAGCTTAATTGCATAGAGTTCCTTCTCGTGGGTAGGCCAATT
TTGTTCATGCACACCCAACTTCTTGGAGAGGAAAGCTAACGGATGATCGTGTCCGTTGTGCTTTTGCGAAAGTACTCCACCCACACAATATCCTGAAGCA
TCGGTTGTCACGATGAACGGAAGAGAGAAATTCGGTAAAGTCAGGACTGGGGCGGATTGCAATGCTGATTTTAGCTTGCTGAAGGCGGTATCATGCTCTT
CATTCCAATTCCAGGTATGGTCCTTCTTGACTAGAGGTCCAAACGGTAAGGCGATTGTCGCGTAGTTGCAAATGAAGCGACGGTAGTAGCCTGCTAGACC
CAAAAAGCTTTGCAATTGCTTTTGGTTCATGGGAATTGGCCAATTGGCGATCACTTCAGTTTTCTTGGAATCCACCGCAATACCTTGACTTGACACGGTG
TGGCCCAGGAACTGAACTTGATTCTGCCCAAAATGACATTTCGAACGATGACAGTACAGCTTCTCTCTGCGTAACACTTCGAAGAGCGTGCGGAGATGCT
GCAGATGCTCCTTCATGTTCTTGGAAAATACACAAATGTCATCCAGATACACCACGATAAACGGATATTTGCCTAGTAGGACACGCATAAGACGTGACCA
GACACCTGGCATTCCAGCAAGACCCATTGGCGCAACACACCACTGATAGGTCTCAGAATGAGTGCGGAACGCTGTGTACTGACGACTTTTCAAGGCAATC
CTCATCTGATGGTAACCTTGCGCGAGATCCAAGACTGAGAAGATGATGCATCCATACATCTTGTCAAATGTTTCGTCAACTCTTGGGAGTGGAATTCTGG
CGATGATCGTTTGCGAGTTGAGCCAACGATAATCAATCACCCAACGAATCGGTAACGTAGCATTTCCCGACCGTAGCCACTCAGCTCGAGAAAGTTGTTT
CCCTGATTTCGGGTCTTTCTTCGGGATACCAAAGATGTTGGAGACCCAAGGTGAATCGGATAGTTCGATCCAACCTTTCTTCAACTTTTCTTCGACAAAC
AGATCAAGGGCATCTTGTTCTGTCTTCGAGAGCCGAAAAGGTGCGCGTGTGCTTGGCATAGCATCTGACTTCATGTTGAGCTCGAATTCCACGCGTCGAT
GAGGAGGTAACCCATCGGGTAAAACGTCTGGAAACACGTCAGCAAACTCATCAAGGAGAGGCACAATTTCTTGTGGTTCCTCCGTGACGGGTTGAGCTGG
AGTAATTTTGACGCGGTAAATCTCATCGTAGTCATGGCGCTTGGCTTTGGCTTTGAACTCAGCACCAGATACTTCCACCTTGCGCAACACTGGCTTCATT
CCTTGCGGTTTGAACTGCAGGTGATGAGTACGCCAATCAATAATTGGTTGGTACTTGGTAAACCAAGGTTTTCCGAGAATGACATCGTGTTCAGGACTCA
TAGACCATTCCAGGACCTCTAAGTCTCTGAATCGATAGCCATCCATCTCAATAGTGACCTTGCCCTTGTGAACGGCACGTTTTTTCGTTGTGCTTCCGTC
AAATAAGGTGACTTGAGAGATCATGGTGTCAGGAATAGTATCCACCAATCCAGGACGAATGACATTGCATGTGGCTCCCGTGTCTAACATAATGGTAACA
CGTTTGCCTTCACACAGACCTGGCTTCCGAATCAACTCATTCGGAGCTGGTAGTGACTGGATGGTAGCAGCGTTGAGATCATTTATCTCAACAACTTCAA
CGGACTCTGGCTTTTCAGTGGCCAAAGTGTGAACAGCGAACTGACCACGCTTAGTGTTAGACGGAAAGCTGTTGTTCGCTCCATGATTCTGTCGATTTTG
AAGCTTGAAGCACTGTTCAATCGTGTGACCAGGCTTCTTACAGTACCGACACTTCTTCGGGTTGCCACTGTTGCGGTTATTGTTCTGAACAGGGCGACGA
TAATTGTCACGGCGGGGTTTATGCACATGACCAGTGTCGATTTCCATAGGCTCAGGTTCATTGTCAGCAGGACGCTGTGGAGCCGTGTTGGAACGAGCGA
ATGACGTGGAGTTGGAACGTCCAAAAGATCTTGGAGGTGTCCAACGATTCTTCTGAAACGGACCAGCACGAAAGTGCGATCTGTCATACTCGAGTGCAAT
TGAGAGAGCCTCAGATACCGTCGTGCAACGACGATACTGAACTTCTTCTTTCGTGGGGCTAACAAGACCTCGAATGAAGTACGTGATCTTGTCAAGCTCA
CTCATGTCCTTGACTTGCATGATAGCAACGCGGAACCGAGAGATGTAGTCCTCCAAGCTAGAACAACGTTTTTGCTTGAGACTGTACAATCGATCTCGAA
GACGCTCCTGAAGATCCGGAGGAACAAATTCCTTCGTGAGCTTCTGGATCAAGTCTTGGACGTCACTAATGGAATCCCTGCAAAGCATGTACCATGCAGC
AGCATTTCCCCTGAAATTGGCAGTCATCATGGCAATGATGCGCTTACTCTGATTCTCATCTTGCCAATTAATGTTCTTCGCCTCAAAGTAATGAATAACT
TGGTCGAAGTACAATTCAACCGAGTCACCCATGTTTCCATAGAAGCGAGGTAGGCTTATACCTTCAACTTTGACTTCCTTGCGTTGCGAAGTCAAAACGT
CGATTAGTGCTTGTTGCTTCTGCACCATTTCGACCACAGACTGTGTCAGACGGTCAGCAGACCATCCGCTAGGATTTAACGAAGTCATGATAGTGTAACT
TGAGCTAAAAGCTGATTAAAGTTACGCTACGAATGTACAGCTGCTAGCTACTAGAACTAGAGCTATAACGACACTGTCAACAGCTACTCGAAACGGGCGC
GCTTGATGCTGATAACGCGATCAACAAAAGCACGAACTTCGGTGTCGATGCGGTTGACGCAGGTGTTCAAGTTGTCGACGGTCTCGTAGAGAAACAGTCC
AAACTCAGTCTCGATAACACGGTCGAGGTGAGTTTCGAAAAACGGAAAGAAAACTTCACGGAGATGTTCCGTCAAGCAAGTAACCTCGTACTGCAAATGG
ATAGCAGCACGAACTGTGAAAGCGCGTTGAACGGCTTGTTCAATGGTGAGAATGCGACGATGTTGCTGATCTTCTTCCCACTCACGAGCAGTACGCTTAG
GCATAGACTGGAAAAATACCCGAAGCTTACGCCAAAGCTTACTCGAAAATTACGCGAAAATTCAGGAAACGACTGAAAATTACGCGGATTCTCAAATTCG
GAATTATACGGGTGCTGGGGTTTAGGCAACTACTGATTGGCTGAGCCAAAGTGCAATTACACTAAAACAATGCGAAAAAAAGTTTAAAACAACACTTAAA
CAACGCTACTTAGCGCTAATTCAAGCGTTGGCGCTTTGCCTTGTAATTGGATTTCTTCTGGCAGAAACCCTGAACAAGTAGCTCTTCCTTTTGAGCCTCT
TCAAGTGCTCTTTTACGCGAGCTCTCCTTAAGTTCACGGTCGAATACAGTAGTGAGTGTGTTATGAATACGCACCACTTGTAAACTTAGGATACGGCAAG
CTTCTCGATAAAGTATACGCTCGGACTTGGAGTGAAAACTCTTCTCCTGGTCTTGTAAGTGGTGAGTTAAGCTTGCAAGGCGATTAACTGAGTTTAATCC
CTTAATACGAAGTCGATCTACTGCTTGTAGATTAGGGTCTGGGTTTGAGTTGAGGTTTTTACTTTTTTGGTTGTTCACCTTGGTCATACAAGGCCAAAGG
TTTCCGCAATATACTAGGCTTACGTGCGGGAAGGTGACTAGTGAAGCGAAAAGCGTTAAACTAGTACAAATCCTTCGGATAACTAACCGTTAGCAAAAAG
CGTGAGGCTAGTTAGCGTAATCGACTAGCGAAAAGCGTTAATGTCGATTATGCAAGACTTTATACGGCTAGCGAAAAGCGTTAATGCCGCTAAGTCAGAG
AACACGTAGAGTAGCAGTATATGCGAAAGCAGTAACCCTAACCCGGATAATTTAGCAGTAGTCGAGCTGAAAGCCGAAGTAGCGAGTCGAGTCGGTCGAT
TGAAGATCTTCTGACCACTTGCCCGGCGAAAATGACCGTAAGTGCTACCAGATGTAAAGCTTGAGCTAGTAGAAGGCCGCGAGTGAAGGTAGTCCGCGAT
GTGGAAGCGTGTAGGTGGTTAGACGCAAATTGCAAAGTGATATTAGTTGGTTAAGGCCCTGTGGCCGGCCGTCTGGGCAGTGCCCAAGGCGGTGCTAAAA
TGAATGAATTTGATTGGTCAATCCACTTCAAGTTGAAGTGGGTTGACGTGCGCTATACAAAAGTAAATGTGCACGACAGAGATCATGCACCACAGTGCAT
GGTCTTTACTTACCCACTTGTCTTTGCGTAATAGTGGATGTTGTAGTTTGGATATGCGGGCCTTGACGTGCTCGTCACGTCTCGGTCCTTACAGACACAC
TGTCGGCATGATCGCGTACATGCGTCTGGATCCAAGCAACGGGGTGGCGGAGGTCGGCCGCATCTACTACACCTCCCGCCTGTCGAAGACCCCTGCTGCC
GCTGAAGCTATGTATCTCCTGGCCGCCAACGCTTTCAAGCTCGGCTACCGTCGCTACGAGTGGAAGTGTGACAGCTGCAACCTGCCGTCGAGAAACGCTG
CTACTAGGTATGGATTTACCTACGAAGGACTTTTCCGCCAGGCTACCGTGTACAAGGGCCGCACTCGCGACACGACGTGGTTCTCCATCATTGACAGCGA
TTGGAATGGCGGCTTGAAGGACGCGTTCGAGCGCTGGCTCAAGCCCAGCAACTTTGACGAGGACGGGCAGCAAACACTGAAGTTGTCCGAGTTGACGGCT
CCATTTGTGCTGGCCAAAAGCTTGTGATTGAACAAGGGAGCGAAGATTGGAGTGGCAAACTACGTGTAAATCGTCTGCGATCTACACTGTGAATACACCT
ACAACTTTTCTTTTTGAAGGCAGGTAACTTGCCACTTTACGAAGTAGAAACATTAACCCGTGAATGCAAGGTAGAACTCAATTGCTCAATGCAAGCTGCA
TGCACTATAAGCACTGCGGCGACATTACACTCACTGCTTCGCGATCGCCAATAACGACGTGTTCGCGATGTTGGCGTCGAACGTGACAACCAACTCGCCC
CCTTTCTCCAAACACGGCATGCAGTGCACGCGTGTCGATACGCACTTGTTGCCGGCGCCTCCGCAGTAGCACAGCAGGATCGGCGTCCCTATCTTCCAAC
ATCCTTGCTTTTCGGCATGTTGCATCCTTCCTCGTGTCTCTTACGGCAGGAAAGCTAGGTCGAAGAGGAGATCGTACACATCATTGATTTGCAGGAGGTG
GCGGTTTGCATTGTCGGCATCGACAGTGCTTTCGGACGATTTGGGTGATCGTGGGGCCGCCGATCGAGCAAGTAAAGGCGTCAGCACCACTGTCAGCTCA
GGTGGGAACTGTGAAGTCGCAGAGGAGCGAAGTGCGTTCATCAGTGCGTCCGAACCCACTGCACTGGAGGTCATAGAGCTGGGATTGCTCGGGTCCAGCG
CTTGAAGCAGCAACGTTGCTGCATCCATGAGTTCTTCCATGAGGAGGCAGGTCTGGACACCTCGATGAAATCGTGCAAGTCCGACAGCGTGAGTGCTCGG
AGTCTCCTTGCTGTGTGTACTGTTGGCGACCGAGAGCGCAGTTTCAAGGAGCCGTGTCTGCAGAGGCTTCGGGAAGTCGACGCTCAGCTGCTGCAGAAGC
TGCACAAACGAAGCCTCACTGAGTGTGGCAGGGCCACCAGCTCTCACTTTTCGGGATGCAGTCGAGCCTCGATA