Description :
From Genome Similarity Track
Location :
contig_34:209274- 210579
Transcript NameFunction/comments
g6612.t1hypothetical protein

Sequence
1305 bases(100 bases per row)
GGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCC
ATCAAGCGACCAAAGCCTTTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAG
GTCACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGC
CGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCTTCTTGTA
GTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGTACTGCTCGTACGACCAACC
GAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTCTGGACCCGCGAGGAACACTCCG
CGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTTGTTGACCATGAACGCTTGACCTTG
GCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCACGACAGCGAGTCG
GCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCAACCG
CGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTCGTGAAGAAACGCCGACGAAGAAAGAG
CTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAGCTGCGAGTCCTCC
ATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTCACTTCCCCACTCG
TCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCCGTTGAACTTGTTGATGCGGGCGGTCGTGGT
CGGGG