Description :
From Genome Similarity Track
Location :
Scaffold_44:209267- 213796
Transcript NameFunction/comments
Phyin_T30-4PITG_16410Putative uncharacterized protein

Sequence
4529 bases(100 bases per row)
GAAGGACTAGGATGGTAAGCAGTGCTCTTACAATAAAATAAAATATTGTAATGGGTTTCACAGAAGCACGTAATAATCATTGCAATATACCGATCCACAA
TAATAAATTATTCAATTATTTTGCTGTATTGCACGGGTCAGGACGGGGCAGTGACCCTATCACGCCACTGGCTTGGGTTCGAAGCAGTGTTGGCTGGTTT
TTGGTTTTTAAATTTAATGGTTTTATATGGTTTTATATGGTTTTGTTGTAGAGAACACCAGTGTAAAACCAGTGCACCTGGAGGTTGGTGGTGATTCACT
GGACGGAGTGATCCGGTCCCCACCGTCAAAGTAATACTGATACCACATACAACAAGTCTCTATTTCTGAAATACGCACGCTCGACAAGTGTATTTAGCTA
TCGCACATCGAACACTACACCGTACCGAAGCATGGGCCACCCATCGTGCCAAGAGCGCGACGAGTTCACAGACTTGCATGAAGACGCCGGTAACAACCGG
ACATACCACATTTGCAACCACTGCAACAATGCGTATCGTGCTTCGCGGCAGCCAGCTGAGGGTAGTTACCACGCAACACCGCACGAGCCTCCTGTCCCTG
AGCCGAAGAGACTTCGAGGGAGTGCCGGAAAACTATAGAAGCCATCTCAAGAGCTGTAAATTCTATCAAGCCTATATTCAAACACGCAACTCTGTGGAAG
CTGCTAGCCGTTCTTCCAGCTCAACAGCCTTTCAACCTAATAGCAGTTCGTCTGTTCACGACGATGCGTCCTCGACACGAAGTGAGAAAAGACAGAAGCG
TATCGACCAGTTTTTTTCAGGACCATCGCATGACGCGGAGGGAGAGATCTTCATGAGATTACTAGTTGAGTTTCAAGCTGATAATCGGCTTCCTGACAGT
TTTATTGAGCGCTTATCTACTGTGCGTTTCTGCGTCACGTAAGCAAGATGATCGCTGACATCTTCCCACTACCAACCCGCAAGAAGCTTGGTGGACCCTT
TCTAGACGCGTACGCTTTCGACTGCGAGAGCCAAGATAGCACGGCACTTCGTAATGTACAATATGCCAATGAAGGTGCGCGTGAATTTCTTAAGTGATGT
TTGGCAGAACATTTCTCGCGCTCACTTGCTTGGTTGCCAATTGGTTCTTTTTGGTTGTGGTATGACATACGCTTTGCTTCCTACGGGACCCAGGCATGAC
GCTATCGCAATTGCGGAACAAATGGAATGTATGATGGAAAAGATGCAGAATGATGGTTGGATAATTGGTGGCGTTGTTACCGATAATGCCGGACAATGCG
CGCGGGCACGACGAATTTTAAGTCTACGGTGGCCGCATATCTCATTTCAGATCTGTTTTGCTCATGATCTAAACAATTTAGTCAATGCAGTTCTAAAGTC
AGATTTTTCTGAGGTCACCAAGCAAGCATCAGACGCGGTCAATGCTCTGAATGCGTCTTCCGCAAAGTGGTTAGTCGAAGCAAGGACGTGCATGGTGGAT
ACTTATGGATATTTCCTGAATCTGAAACAATTATGTGAAACCCGTTGGAACAGCATGCATGGATGTTTTGCATCGTTGTTGCGCGTTCAAAGTGCGCTTG
AGTTACTAGAGTTTAAGTTTCGAGCTGGCGATGATTTTCCTGATGCTGCACGCGTTTTTAGCAGAGGATCATTTTGGGAACGGCTTAAAGACGCTGAAGA
GGTGGTGCGTCCGCTTGCATTTGCCTCTTTGAAGTTGCAGCGCGACGAGAACTCGCTCGCGGATGCTGTTGTGTGCTACATGGATATGATCAAAGGATTT
TCGGTGCGTCCGTTTGGCACGCGCAACCTTATCAAGCAAGTGGAGCAGCGATGGAAACAGTGTGAGCAGCCGCTCATGTTGCTCGCTCTATTTTTACATC
CTTTACACACCAATGCCGCTCAAAAGCTGTTAAACAAGACCCCGCTGACAACGATAGGCTCCCTGTGCCGCATCGGCGTTTACTATTATCGGCGATTCAC
GCGCGCGGACCCCGGCAACTTAGGAGAGGATATTTACAAGTGGCTGAAAGGAAAGCTAGCACTTCCACCACAGGGAGGGTTCAGTATAGTCAGTTCGTTC
TGGGATTTCATGCGCGATGACATGCCTTTTAGCAAGTTGCCGATACTTCCGATGCAAGTGCTGTCTATTGTGGTCAACACAGCAACATGCGAGCGCTACT
TCAGTGAGTTAGCGCTGATTCACACAGCAAAACGAAACAAATGTCGGTGGAGAAGGCTCGCAAAATCGCCGCTGTTCGGAAGAAGGTTCGTGAGTCGGAT
CAGCTTGATAGCATCTTGAAATCCCAGCGTATTAAAAAGCTGATCAACCCAACAGAGCACCCTCGACGCCAAGACGAGCGATTTGAATGCAACCAAGTCG
ATACTGAAGTTGAGTCAGACGACGAAACAGGAAGTGAGTTGGGGGGGGGGACGATGCTTTTGAATACTGGGGTGCTGTTCTGGCAGAGCTAGATGGAGAT
GAAGACGTGCCGCCACCGAATCACAGGGCTGTGGTTGAGATCAGTGAGTTATCTGCCGATCGAGCGTCGTACTGTAGTGATTCTGACAGTAGATCGAGAC
CAATACTACCGGCAGACCGGGGCAGTGACGAAGCTGAGCGTGCGCTCAGAGACAAGATTATCAAAATTGCGCAGTAGTCCGAGGAAGACATTCAAGAACC
TATTAAGGACCCATTTCCTTCTTTTAACGACCGCAATTTTCCACAGCAAAAAGTGCTGACGGGGCTACGTGGTCAGAAGATTTCGTTGGCGGAGCTATGG
GATACGTCGGAAGCATTAACTGAAGATCCAGGTAAATCGTTCGTGACAACACTTACTCGGGTATTTGTACTAACTCTATGTGATGGTTTAAATGCAGTAT
GGCATTTTGCGAGCCCGGTGCGCTTCCGCCGAGAGGGGCAGGTTTGATCAACCAGTCGATGAAACGATAAACTATGGTAGGGTCTTTCAGTTGGAGTGCG
TTGAAATAAATACACGCAGTACACATTTGTACGAAGTAAATGGAGAGGAACATTCGACTACGAATGCAGCCTGAGCACATAAAACGCAGCGACTTCTGGA
AGGTTTAGCGAGTCCCAAACTCAGTAGCCGATCGTCGAGCCGTCTGGACAATGAATGGCGTCTGTAGACAATACAACCTGATATTTGTATATCACCTTCA
CGCTTTCACTTTTATTAAATATCTTTAAAACGTTCAGCTCACAAACGAAATAAAGAAACCTAGTAGGACAGCATAGCACCAACATATTAAGATAATGAAT
TAGCTGGTAGTTCGTATGAAATGCAGGAAGTGTGCTCCACTTACATACCAACTCAACAGCGTCATCGGCCTCACCGTCTTCGTCACGATGCTGCCGTCGG
CCTCCTGCGACGGGAACACCTCCGTCTGAACCGACTCACCCGGGGCCGCACCGGCCTCCACGGTCGACCGAATAGCGCGGCCACCAGACGTCGACGTCGT
CGCGAGACCGCTCACCTCCGTCTCCACCGTCGTGGTTTTCTCGCCAGACGTCGTCTCCGTCTCCGTTGTGGTCTCCACCTCGACCGTCCTCACCAGCTCG
CCGCTGGCACTCATCGAAGTACGCGTCGTCGTCTTCACCGTCTTCGTCACGATGCTGCCATCGGCCTCCTGCGACTGGAACACCTCCGTCTGAACCGACT
CACCCGGGTCTGCACCGGCCTCCACGGTCGACCGAATAGCGCGGCCACCAGACGTCGACGTCGACGTCGTCGCGAGACCGCTCACCTCCATCTCCGTCTC
CTCACGCGTCTCCGTCTCCACCGTGGAGCTTTCGCCACGGCCGGCGCTAAGGCTCTAGAGACCAATACGTTCACGCTACCGACAGCAGAAGACTACATCA
TTGTGGGTCTAGTGGAGCTACCAGGCGACAGCTCGCTCAGTCTTGCAGCAGAGGAGTACGTCGTGTTCAAGAAGATCAGCGTCGTCTCAGCGGACACTGT
CATTTCGTCATCATTCTTAAGTACAACAGGTAGCGTAGGAAGTTCTGAATCCAGTGCCATGAACTCGTCCACTTAGTCGACCACAGCTGCCCCCGTAGCC
ATTACACCGCCGCTAACTTCGTGTGGTAGAGCTTTGTCGCATCTTGAGCGTACCCAACTTGAGTTTTTTTTCGTTTAGCAACATTACATACACAATGCGT
ACACCATACTAATTGCCAGTAATAACACCAAATAATCATAGTAACGCCACCAAAACTCCAGAAAAAAAACAACCATGGTGATTGGTGTTAATGGAGTATT
CCACCAGTGGTTTAACCAACACTGTTCGAAGCCCACTGCTGCAGAGAAGGCTGGTGACTATCATCCAAGCTGGTTTTATTTAGCTTACCAAATATAGCCG
GCGACGGCAAGATACGAGCCAGCCTGAGCAGCAGTTTTGTTGGGTTCTGATAAAAAAAGAAGTCTAAACCTTATTTCGGCAGCGTTGTAGCCCTCAAGTT
TCTCATGCGCAAACTACTTTCTAAATATA