Description :
From Genome Similarity Track
Location :
Scaffold_379:209241- 211177
Transcript NameFunction/comments
Aphin_H310_07047phospholipid-transporting ATPase, putative

Sequence
1936 bases(100 bases per row)
AACGAGGACTTGGGGCAAATCGAGTACATCTTTAGCGACAAGACTGGCACACTGACGCAAAACATCATGGAGTTTCGCAAGTGCTCGATTGGCGGCGTCG
TGTATGGTTACGGGTCGACCGAAATTGCCGCGGCCGTCGCCAGGCTCGCCAAACATGAAGCCACGCCAGCGACGGCCAACGACCGTGGCCCCGCGACCAA
TTTGAACGATGCCCAGATTTTCCTCGACAAGTCCATTCACTTTGACGACCCGCGACTCGTCGTCGAAGCCGCAAACCCGTCGAGTCCGAACGGCGCTCGC
ATCCGCGAGTTTCTCACGCTCTTGGCCGTTTGCCACACTGTGATTCCTGAAACCAATGCCACCACGGGCCTGACGACGTACCGCGCCTCGTCCCCAGACG
AAGAAGCTTTGGTCAAGGCGGCGCGGTGCTTGGGCTACAAGCTCGTGACACCGGCGCCTTTTGTCGAAGTGGAAATCACGCACAAGGGAACGAGCCCGAC
AATGTTGGGGTACTCGATTTTGAACGTGAACGAGTTCAACTCGACCCGGAAACGGATGAGCGTAGTCGTGCTGACGCCGCACGGCACGGTTGTCGTGTAT
TGCAAAGGCGCGGACAACGTGATCTTGCCGCGATGCGCGCTGACGAGGACTGAAGCGGTCTTGGACGAGCATTTGAAGACGTTTGCGTCCGAGGGCTTGC
GCACGCTAGTCCTGGCCAAGCGCGAAATGTCCAAGGCGGACTACGACGCGTGGAACAAAACGTACCAGGCGGCTGCAACGTCCTTGTCCGATCGAGATGC
CATGCTGGATGCAGCTGCAGAAGCACTCGAAGTCAACATGACGATTGTCGGGGCCACTGCAATCGAAGACAAGTTGCAAGTTGGCGTTCCCAACGCGATC
CACAGCCTGGCCCAGGCCGGTATCAAGATTTGGGTGTTGACAGGAGACAAGGAAGAGACAGCGGTCAACATCGGGCACGCATGCCGCTTACTCAATGACG
GGATGCAGTTGCTGTATGTGAATCGGGAAGATTTGGCAGGCCTTGTCGAGCAGGTCGGTCGGATCGTTCTCCACGGACGTGATGTCAAATATGTGTGGTG
TGGAGTTGAATGGTTTGTCTAGGTCGACTACTTGTACAACATGGAGGCGATTCAAGACCACTACAAGTCGAAAACCGTGGCGGAAAACATTGGCATCGTG
TGCGACGGCAAGTCCCTCGTCCATTTTTTCCCGTCCAAGTCGTTGTCGGCCAACGACAAGGTCACGGCCAAGGAACTGCGGCGCAAACTTCTCGTCGTCG
CCAGTGTTTGCAAAGCCATGGTTGCGTGCCGCGTCTCGCCAGCCCAGAAAGCCGACATCGTCAACTTGGTATGGCCACCGCTACTGCAGTCGTCTCCAAG
TAAAATGACCGAGCGACTTTCGTCCTTCTTACCCAGGTGCGATACAACTCGCGAAACAAGCCCATCACGCTTGCTATCGGCGATGGAGCGAACGACGTCA
ACATGATCCAGTCGGCGCATGTCGGGATTGGCATTTGCGGCCAAGAAGGGGTACAAGCCGTCAACGCCAGCGACTATGCGATCGCTCAGTTCCGGTACCG
TGCTTCGACCAGTGCCACGACGAAAGTAATTGCTGTGCTAGCTTTCTTCAGCGGCTGCTTCTGGTCCACGGCCGATCCAACTACAAGCGCATCGCCAAGG
TCATCTTGTACTCGTTCTACAAGAACATGTCGCTCGTGATCGTGCTGTTCTTTTACAACTTTTACAACGGCCAGAGCGGAACGTCGCTGTTTGAGAGTTT
TGTCATGGCCGGGTGGAACTTCTTCCTGGCACTGCCGATCATCGCGATCGGGATCTTTGACGAAGACGTGAGCCCGGAACAAGCAATGGCGTTTCCCGCG
CTGTACACGACCGGCCAACGCAACGACGACTTGAAC