Description :
From Genome Similarity Track
Location :
Scaffold_24:20917- 26579
Transcript NameFunction/comments
Physo_108670predicted protein
Physo_115231hypothetical protein
Physo_108671asparaginyl-tRNA synthetase
Physo_133038predicted protein

Sequence
5662 bases(100 bases per row)
AGACCCTTCCACAATGCACCGACACCCTCCTCCTTCGAGATGACCTTCATGGCGTCGAAGAATCCCTTGTACTTGAGCTCCTGGCCGGCCACGGTCTCCT
GCGCCATGAGCCGCGTCTTGAGCACGTCCATGGGGGTGTTGAACATGGGGCCGAGCGAGCCGGCGATCAGGCCGTTGATGAACGTGGCGTACGTGGGCAG
CGTCTTGCCGTCACCGTCCTGCTTGTCCCACACGTGGTGGTTGAGCCACGCAAAGGCCATGAAGTTGAAGGCCTGGTTGCTGCCCTGGCGCGCCATGGTG
GGGATGTTGCCCTTCCAGAGCGCGCGCACGCCCTCGTTGCGCACGATGTGGCGCGTGCAGTCGATGGGGCCGCTGAAGCGGCCGACGCCCACCTCCTTTT
GCATGCGGGTCTTGATGACCTCGAACGGCGTCACGATGATGACCGACTCGATGCAGCCGGCGAGCAGACCGGCCGTGAAGTTGATCGTGGGGGTGATCGG
CTTGTCCTTGCCGCCGGCGATCTGCTCCTTGAACCACGCGAAGGAGCCGAAGCGCAGCGCGTACTTGAGCACCATGTTGGTCACGAAGGGCGTGAGCCCC
TTGTAGAGCGCGAGGCCGCCCTCCTGCTTGTAGATGGTCGTGCCGCAGTTGACCATGCCCTTGTACTGGCCCGTGCGGTCCAGCTGCAGGCGCGTCTTGG
TCACGTCCAGCGGCTGCAGGATGCAGGCCTCGGCCACGCCACCGGCCATGCCGGCCATCATCTTGACGTACACGGGCACGGGCCGCTTCTTGAGGTCGGC
GCCCATGGCGTCCTTGAGCGCGCTGGTGGCCAGCAGCTGGTCCTTGTTCTGCGTCTGCATGTTCACGAGCGGCGTCTTGGGCGTCTGCATTGTCCCGGGC
GGCGGGTGTCCAGAGGTGGTGGGCGAGGTAGAACGGGGCGGTGCGCGGCAGCGTGGCAAAAGGAGAATGGCCGGCTCGAGGCCGCGACTGAGGTGGCGGA
GGACGAGTCGAGCATGACGCCGGCGTCGGGGCTTTGCTTGCTCGTCCTAGACTAGACTCGGGGGGGGGGGGCATACTGAGCGCAAGTCATCGGCGCGGAG
GGGGTCGGGGTTCAATCAGACCAACTTTGGAAGGTACAATATGATACAACCTGAATCAGGGCTGGCATTAACTCTGGAAGGTTGTGCAGATCCATGTCCC
GGCTGCGCACTTCAACGACGCTTTTCACGGCGAACACGTTGCTTGCGAGGCACCTGTTGACGTGCTGGTTGTGCGCCCGTGTAAGATTCGCAAGCGCTTT
TTCGGCGGTGGTGGTGTTGCGCTTCAAGGCTGAAAGCTCCACAGCTTACAAATCGGGCCGGATGGATGGATATTGGGCGAGATGTATTAGGATGGACATT
GAAGACCGAAGAGCGCGGCGGAATTCGTCACCGAGTTGGATTGCTACTAGCCCGGGGGTGATGGACTAACTCGCCTGCCAGCATTGCGACAGTCGGCACA
GGCAGTGCTCCGAATAGCTGGCGCGGATCCTGAAGCGGCAGTTTCTCGTCCGTTTCGACGTGAAAGACGAGCAGCATGGCGCCGCCGCCGCGAATATTTT
CTCGTGGGCGCTAGGCGCGCAGTAGCCACCTTGGCCGACCAACTGCGGCGCCAACTGCTGCGAGCTCCAGGCTGGCGCGCGAGACAACTTCAAGGAAGTT
TCAGTTCTAGTCCAGGGACGTGACAGCACTGCGTCGACCCTGCGCCCTAGCGATCTAAGTTGAAGCAGTAGATGGCTGCTTCGACGACAGCGAGCTTACG
CACCGGAAGAACTGAAATAAGCAACATGTCTAAGCGACATACAAAGTTCCAGTTGGATGCCGGCCAATCCAAGGCTCGAGTTCCAGACGTTAAACCCCGC
TGACGCGCAAGGCACCTCCGCCGAACTTCAACGCGAGCAAGCGACTCGCTTGAGCGTCCAAGCACGTGATACGACGACGATTTGCTCCCGCGCTCCAAAG
CACGAAAGGCAAGGTCTCCGCTGCACTACAGCACACCAAAGTGCAACAACAACAACAACAGCAGCAGCAAGCAACAGTTCTCTCAAACCAACGTGGGTCT
CTTCATTCTGCTCAGGGCAGTTCGATCAGTGTGCACGCACTCCCGACGTTAAACCGCGCGTGGTCAGCATCGTGCTCCTCCTTCACTGCGTTTCCCGGTG
CTGCCCACCGAAATCCCTGCCTGACTCACCCACTACAAGTATCGCCACTGCCGCAGCAGTCCCGTTAATTGAACTCCTGGGCGTACTTCTCCTTGGCCTG
TTTCTCCATGTCCGGGTTCACGCGGCCCGTTGTGGGGTCCGTGCCCAGCGGGCGTCGGAATAATAAAATGTGCGGCTCCGGCCTGCAACGCAGCAGCAGC
AACACAAAACAATAGACGGGGTCAATCAACGCTGCTTCAGATATGACCAAGCAGACCCACAGTCTGACTGGTCTCAGCCCACGAAGCAGCTAGCGCGGAC
GGAGCATCTCGCTGCGTGAACGTACTTGTGAATGGCGTAGTGCACCCAGCCGCGGCTCTGCTGGACGCCGAGTTGGCGCCACTCCGTCTCGGTCAGCAGG
CGGTCCGGCAGGCTGCGCTGCATCTCCTTGGGCAGGATCACGTGTCTGAATTGCAGCAGAAATTGCAACAAATTGCAGCGAATAATTTGAATATTGTTAG
CCATCGATGCGCATTCACGCGTTGCGAGGCCGATTCTGGGCCAATTCCCGCGGCGGAAGCGGGCGAGCGACGCACCTGTACTCGTGGGTGTCGTCCACGT
ACTTCTCCGAGTACTCGATGCGCGACGACAGGTCGTGCGTCATGGCTGCGGCGTCTCTGGAGGCGGCGGCTTCGCCCTCGCTGCTCTCTCGGTCAATTTC
GCGCTCTTCTCGATGTCGCACTCAATAATGGCGAGTTATGTGGTGTGGCGCACGTAAATAGCTTCGTTCGGAATTAGCCGAGATAAGGCGAAGTCGGTCT
TGAAGGGACGCACGCACACGATGGATACCCTCGCTGTCACTTGCGACTTGAAGGGCGAACGAAGGCAAGCATGACGCGCGAGAATGGCAAGCAGATGGAG
ACGGACAGTAAGGTGGCGGCATTGAGATCAAAAGGATGGATGGATGATGCTGGTGGTTTTGGCTGACTGAGTGTGGCTGCTGTGCTGCCCAGTGGACGAG
CACGGGGACATGAAGAACGATGCGCTGGCGCAGGCGAGCGTGGCGCTGGAGCAGTTCACGCAGGAGAAGGAGATCGCCAAGCACATCAAGACGTGGATGG
AGGAGAAGTACGGCCCCACGTGGCACTGCATCGTCGGCTCCGAGTACAAGACGGCCTTCACCTACGAGAGCAAGAACTTCGTGCGATTCAACGTCGGCAA
GAAGTGCATCACGCTCTTCCGCCACCCGTAGGGCGACTTGGCAGTACCAATCTCTTATCATCTTGATGAACATCAAAACACGTGAACGTATCTTGCAAAT
GTTTAGATTTGTTTACTCGGGACAGGGATGGAGGGGCCTTACACTGCCAGCAACTGTGACTAGGCTTGCGCCATCATAAGCACCGTCTCGAGCAACGAAC
TCGCCTCTAGTCCGCGAAGGAACGTCAAGCGCCTACCTCCCAGCGACTGCTTAGAAGGCGGCGTTGCCGGGCCACCGCGGGAACGGAATCACGTCACGGA
TGTTCTCAATGCCAGTCACGTAACGAATGAGACGCTCGAAGCCGAGACCGAAACCGGCGTGCGGCACCGAGCCGTACTTGCGCAGGTCCAGGTACCACTT
GTAGTCCTCCGGGTTGGCGCCAGACTCCCTGATGCGAGCCTCCAGCACGTCCAGACGCTCCTCACGCGCCGATCCGCCGATGATCTCACCGACGTTGGGC
ACCAGCACGTCGGCGGCAGCCACCGTCTTGCCGTCGTCGTTCAGGCGCATGTAGAAGCTCTTGAACTCCTTCGGGTAGTCGTAGATCACCACCGGCTTCT
TGTAGACCGTCTCGGTCAGGTAGCGCTCGTGCTCCGAGCCGAAGTCCGTGCCCCAGACGGGCTTGACCGAGAACTTTCCCTTCTTCAGGTGCTCCGGCTT
GAGCAGCAGCTCCACGGCGTCCGTGTACGAGATGCGCACGAACGGCGACTCCACGGTGGCGGCCAGACGCTCGAGCAGGCCCTTTTCCACGTTCTTGTTG
AAGAACTCGAGGTCCTCGGTGCAGTGGTCCAGCGCGTACTGCACGCAGAACTTGAGGTAGTCCTCGGCCAGGTCGATGTCGTCCTTGAGGTCGGCGAAGG
CGATCTCCGGCTCGATCATCCAGAACTCGGCCAGGTGGCGCGACGTGTTGGAGTTCTCGGCGCGGAACGTGGGGCCGAACGTGTACACGTCCGAGAGGGC
GCAGCAGTGGGTCTCGACGTTGAGCTGGCCCGAGACGCTGAGGTAGGACGGGCGGTCGAAGAAGTCCTTCTGGTAGTCGACCTTGTTGTCCTTCGTGAGC
GGCAGCTTGCCGTCCGGGTGCTGGCTCAGCAGCGTGGTGACGCTGAACATCTCGCCGGCGCCCTCGCAGTCCGACTCGGTGATGATGGGCGTGTGGATGT
ACAGGAAGCCGCGCTGGTTGAAGAACTCGTGCGTGGCGAAGGCCATGGCGTTGCGCACGCGCATGGCGGCGCCGTGGATGTTGGAGCGCGGGCGCAGGTG
CGCGTGCGCGCGCAGGTGCTCGAGCGTGTGGCGCTTCTTGCTCATGGGGTACGTGGCGCTGTCGGGGATGCCGCCGTAGACCTTGACCTTGGCGGCCTTG
ACCTCGACCTCCTGGCCCTTGGCGGGCGACTTGACCACGACGCCCTCCACGCTGAAGCTGGCGCCCACGCCGCCCGAGGCGATGGCGTCGGCGAAGCCCT
CGGTCTCCTCCTTGTTGATCACACACTGCACGCCGGCGAAGCACGAGCCGTCGTTGAGCTCCAGGAAGGCGAAGGCGCCGGCGCCGGCCTCGCGCAGGGT
CTTGGCCCAGCCCTTGACGGTCACCATCTGGCCCTCGAGCTCCAGGCCGCTGCCCAGCAGCTCCTTGACGCGGATGCGGTTGCGGCGGAACAGCGTCGGC
GCCGTCGTCGGCTTGGCGGAGGGCACCACGGCGTCCATCTCAGTCAGTCACTCTACGGGGGGATCTGCGCTTCCGGTCGCGTTGCGAAATGGTTGCTTGG
ATCGGACATGGCGGGCGTCGGCAGCGCATAAGCACGCGTGATTGGATGATAGGCGGGGGGATCGAGATTGCGATTGGAGTAAAATGAACTTTTTCTTGTG
GCTCGAGGGGATGGATGCATACAAGAGATGAGCTCCTCGCTGCGCCGGACGCTGCAGGTCGTGGGCGTGCGCGTGGCGGCCGCCAAGGCCGGCAAGGTGG
TCAAGCGGCTGCAAGGTCATCTGCTGGATCTGCCGCGCCTGCGCAATGTGGTGCCTGACCCGGCGCGCACCGACATGAAGCTGGTGCTGCTCAAAGCCGA
GGCGAAGGACGAGAATGCGCTGAAGCCGCTGCGCGAGCGGTTGGCGGAGTTCCTGCGCGCTGGGAGCTTCAGCTTTGTGCCCCATGCAGTGCAAATCGAG
TGTAGCCAAGATGCAGCATCGCGCAAGGCAATAGATCAGAGCGACGGAGTGGACAATGCTAC