Description :
From Genome Similarity Track
Location :
Scaffold_8:209161- 213094
Transcript NameFunction/comments
Physo_129530hypothetical protein
Physo_129531Avh_263
Physo_159219PsAvh263

Sequence
3933 bases(100 bases per row)
ACTTCGCACAGGCCTCAGCGATAGCTTCGGGACTGTAAACTTTGCGTACGAGCTCTAACAGCGGGCAGCGCGACTTGACCAATTCGTAGCTCTGCATGTA
GGACGCCAGCATCTCAACGACAACGCGCCGGCGGTCCTCGGGGTATCGAGCCAGCACCACTTGGAAGTCTTCTCGGGAAAGCACACACATCTCCACGTGA
GTGACGGCCCGTACATTTGCTGCGCGCTGGTAGTTCATCAGCAGTGCCATATCACCGAAAGCTTGGCCTCTGGAGATGAGGACATCGTGACCTTTACCTC
CTCGACCTCCCGTGCGATAGTATCTCCGCTGGGCTGCATCCAGCTCGTACGCTGACTGCCGAGACCCATCACTGGATTGATCTCCATTGGTGGGGCCATT
ACGACGGCGAACACCCATGCCGCTGTTACTACGGCCGATACTAAAGCCGCCATTGCTTGGTCCTCCTGCTGTGATCGTTGAGGTGGTCACTCTCTCGAAT
CGGTTCTTATCGCGACCAATCTCGCAGTGCCCGCGATTCACCATGTAAAACTCGACATCTACCTCTCCTTCCCTCATAATAAAGTCGTTCGGCAAGTATA
CACGAACATCAAGCCTCAGCATGAGCTGCTTCTGGAAATCCGGCGTGCAATCTTTCCAGAACGGTACATGCATCACCACCTCCATGTACTTGAACAGCAC
GACTTCAAGGCCAAGCGTGTGTGACAACTCCTTGGAAAACTGGACAATCTCGCCGTCTAGGCACTCGTACTCGTGCCACAGGTGCTCGTAATACTCGTGA
ATGCGTTCTCGTAGGGGTGCTGGCAGCTGGAGTTTGGCGGTCATGGCGAACACTTCCTCCATTTTACGCTGGTAGCTTGTAGTATTAGCGTTGAAATTGG
AGACTAGGATGGCGACGTGGCCGAACACCACTGCCAAGACGATGGACCCCACTATCACCGACAGCGAAGCGAATAAATTCTGACCTGCACTGTTGGTGGG
GACCCCCTCTCCTTGCAACAACAGTAGAGCCGCATAAAAACTCCCAGAGTAAACGTCGCGCCACGACTCGAACGATTCTTCAAACGTTTCATTTTCCTCC
AGCAAAATCGCCCAGATGCAAGCGATGTAGTGCGCGATGCAGACGAGAATGGCGACAATCCCAGCGATCCGGAAGAGGTGCGAGTAGCGAGAGTACAGCA
GCCAGGCCCAGAAATTGTGGCTGCCTCCGGACTGGTTAGCGCGAATGAGCCAGATCACGCGCACAATCCGCATCATATAAGCCAGGCGCTCTACACTGAG
TACGTCAAGCAGGAATAACACCCATTTGCCCCCTGGGATCGAGTTATTCATGGTGTTGCTGTGCACCAGGAGCGGCACCGAAATCAACGCGTCAATAACG
AAGCGTGTCTTCATGTAATGCCCGAATATCTGCCAATGTGAGACGACAATCTTCCCCGTTTCAGTCATGTAGCCTGTGTGCAGCGTCAACACGACATTGA
GCCCGAGCAAGACTCCGATAGCAGTATCGGCAGTAGCAATGTGGTATTTCTCGTGAAATGCGAGCTCCAGCGGGAACCACACGATGTAAACGACGGTCGT
CATCAACGTGACAGCGTAGCGAGCTTGGGAAATTTTGGAGAAAGGAGAAATGGGCCTCGCTAGCTTCTGCAGAAGTCGCTCGACACAAGCGAGTAAGTAG
TTCCTTGCGCTAGACTGGTAAAACGGCGTCCCGTAGGCGAGGTTATACTGCTCCGTGAGCTGCAAACTGCTCGTGCCGCTTTCGAGTGGCGGTCGTCCGA
CCTCAAATGAGGAATTCACATCGCCTAAATTCAAGAAGCTCGCCTTCCTGGTGTTTGCGTCGGGGGTCGAGGCGTGTTCACTGACGTTGCGAGCCGAGAG
ACGCGGGAGCAAATGGTGCTCTTGCCTTGGGGTGCGGCCTGTGCGTGCACTGGACGCGGTGCCTCCAAAGTCTACCCCCGCTCCTCCCAGAAGGCCTTCC
AGTCCAATCTCCATAGTCGGCGGGGTCCTTTGCAGCTGGCGGATCTGGAAGCGCTCCATCATTTCTTCGTACGGAGACTCACTGGCCTTCCGACGGTTGG
TCAAGTCCGAGTGCGCTTGCATGTCCGACACCGAGCGACGCAAGACTGAAGTCACGGTTGACCACGCCGCGACGGAACTGGAGGGGGTTCCTGCGATGCC
TCGAGACGACACGCTCCTCTTCCTGGCTCGGTTTGCGACTTCCTCCGCCCCTTTCGCGACTGGATGTACGACCCCTGAGGGCATTTGACTTGAGTTTCGT
CGAGAACCCCGGAGAATGCTCCTGTGGAGGAGAACAACTGGCGTGTGCTCCTTCTCCTCCAACGAGGGCGACATCGTAGCTGACCGGGTCGTGGCAGTGT
TCGGCCCCCCATTGAGTTCCACGTTGGAGTCGACAATGTCCGCCAGTTGAGGGGACTCCGCATCAGAGAGCCCCGTCATGGAGGATCTTACGCGTGCGCT
TGCTCTGAGGCTTGACAAACGCGCAATGCGTCGACTCAACTCGACTCGTTTTACTTCGGAAGCGCTTTCCGATATTTTTACGGCAAGAGCCTCACTCGCC
GTCGTTTCTTCTTGTTTTGGCGACTGATGGGCACAGGTCTTTGAACAAGCGCGTGTAACCAACCACCCCCATGCCCGCAGATTTCCTGAGTAAATGTCCA
GCTACAGTGGTGACAAGTAGCTTTTGTAATGCTGCGTTATGTAGTCTAGTAATACTGAATGCTGCAGGCCTGAGCCGGCTATTGTCATACCTGGTGAGCG
AGTGTCGTTCGCGTTTCATGCAGCTCGATACAGTACAGTACCAATCTGCAGATCCAAGTATCATCGCAACGCCGTGGAGCGTTGCTTCCTCTCTGTAGTC
GCGGGCATGCATCAGAAGCTTCCTCGACATCCAGCGCCATGCACCGGGGGCTTCGCGCTGTTAACTCCCGTGCCTCGCGGCCATCTGCTTGAATTGAACG
ATGGCAGTATCTTTGTCGAGGTCATGCTGCATGGTGGCGTTGGCCAGTCGCTGGTTCATGTGGCAGCTTCAAGTACATGTACTCCGCGGGTGATTGCATG
GGGTCGAGTCGGGCCACTCGTGAGGCATTGCAAGCGTTATATTGGGTTGAAGTTGTCGAAATCGTCTGCTCATCTGCTGCGCTTCTCGGGTCTCTGCACG
GAGTCTCCGGCGCTCGTCCGATTCATTCTGTGCGAAAGCTAATCCCGGCCCCCGGCTACGAACAGCGAGGAGCGATTTCCCCGATTTGAAAAATTATGCA
ATGAACGTCGGTCATACAAAACGCAGAGACTTCGATTTGCGACTCCATTCCATGCAGCAACGAACAAACTGAAGAAAAAAAGATGAAGCGAAGCCACCGC
GGCGGCAACTCCCCATCTCTTTTGTTGGTTCTGGGACGCGTATGAACAGGTGGGAATGGCTCATTTCAGAATCGACCGGCAAGGACTTAAAACTGAGCGA
CCGACCGTCTCTACTGCTGGAAGCCCCAAGTCCCCCAAAAGCAATGCGTTCCAACTTCTTCCTCGTGGCGCTGCTCCTCATCACCCTCGCAGTGTGCGTC
CAAGGTGATGACACGCACCGAAGCCTCCGGTCCAGCGTCACCACGCAGGACGCCGAGGCTGAGGAGAGAGTGGACTTGAAAGGGGCTGCAGGCAAGTTTT
CGTCGTTGGTGAGGGAGAAGAGCGGCAACGTGTTGGAAAAGTACCCGTCGGTCGCTGCGATGCTGGGGAAAAACCCCGCGCTGGCCAAGGGCATGGACAA
GATTATCAAGAACGAGAAGCTGGTGGCAGACCTCAAGAAGACCAAGTCGTTCAAGGACCTCCGGACCGCCATCCGCGCCAACCCGCAGGCGGTGGACTCG
GCCAAGGCCGAGCAATTCGGAAAAATTATGGTC