Description :
From Genome Similarity Track
Location :
contig_34:209161- 212274
Transcript NameFunction/comments
g6612.t1hypothetical protein
g6613.t1hypothetical protein ALNC14_088100
g6614.t1hypothetical protein

Sequence
3113 bases(100 bases per row)
GGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACT
CAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCAC
TTTGCATTTTGCCATCAAGCGACCAAAGCCTTTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCC
GTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACA
CCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAG
CCATCTTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGTACTGCT
CGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTCTGGACCCGC
GAGGAACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTTGTTGACCATGA
ACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCA
CGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACC
GGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTCGTGAAGAAACGCC
GACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAG
CTGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTC
ACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCCGTTGAACTTGTTGATGC
GGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTCTTGGGCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGCTTGG
TCGCTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTACTGGATACACTCTACTGG
ATTCCTTACGGATACTGAGTTGCTTCAGCCAGTCAGCGACTGCCACGTGGATCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGT
AGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGT
ATCCTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAACACTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCTGAGTGGCAGCAAG
TATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGTGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGA
AGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACCGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGACGAAGG
CATCGAGTAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCAT
CACGCCAAGTTGGGCAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCAT
TCGAGATCGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCGTGTGCTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGGA
CCCCAAGGCTCGCGCCGGGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGCAGGTGGTTGTCAGTCGCGATGTCA
ACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATACTGCGCTGGACCTGGACGCACTGGACCTGGACGACACCGA
TGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGTTCGCCACCGA
GCTAGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCCGAACCCGACGAAGAAGAAAAGTCTGGGGACCAAGATGAAGACGACGACT
CGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCTGTGAACGGTCCGGA
TCAAGTGTACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGCGCATCG
GCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGTGTAATGGGTCTGCTTAGACCC
ACTACTTAAGCTT