Description :
From Genome Similarity Track
Location :
Scaffold_7:209106- 211358
Transcript NameFunction/comments
Hyaar_Emoy2801468monovalent Cation:Proton Antiporter-2 (CPA2) family
Hyaar_Emoy2801469monovalent Cation:Proton Antiporter-2 (CPA2) family

Sequence
2252 bases(100 bases per row)
TTAATACATTTCTATTTTGCCGCAACTCCAATTTCCAGTGGCAAGGGGTTAGGGTACTATGTGCATGCGTGAAGAAATGCTCACCCGACCTTTCAAGCAT
ACAAATATTAAGACTAAAAAAATAGTGCCCTAAACTGAAAGGAAAAAAATCATGATTTATGTCTTTTAGGAATGCAAGTGGGCTGGGGTTTTGTTTAAAA
AAAATTGAATGAATCAGTCAAGAAATTCCTATTTCTGCTGATTCAAGTCATACCATTTCCTTTTCGATCAGCTAAAATGCTAAGCTGCAAGGATTGATCT
CCTTTAGAATCTATAAAGCTGCACAAAACTGAAAGTTTACGCTACCCTGTATTAATTATGTGCAGATCTCTCGTATATCTTAAGCCATGCCGTGATCGCT
GGTGGGTGATCCGGAGGCTGACCGTGACTGGAGCTAGTAAAGACTAGCACCACGGTAGGTTCGCGCTCCAGTATCTGCGAGGGCGAACCTTGGTACATAA
TGGGGTTTAAAACCCCGAACGCTGTTGACACAATCTGGAGACTGTCGTGTGCTATCGACCGTGCGACAGCACCGAATGTGGGGGTGAACCCTTATCAGCC
GCTTGCGCGACCCCTCGACGTGGAGTAGTCACCGAAGTTTCCGCGAGGCGCGGGGACGCCACCCGCCCCTATACCTTCCCCTTGCCCGCCTACGCACGAC
CCGCGGGCGCGCAAGAGGCGCGCCCAAGTCGTGACCTCTCCCGTTTCGGCTCCCGCGAGGGAGGACTCCCGCCGAAAGGAGCTGCCCTTATCAAAAGACG
GAGGTTTGAACTGACTTAAGCGCGACTAAAATATTTGGGAATATTTGCTTTGCTCTAGGTACACCCGAATGGTTTTCGGTGCGTTTATTCGGGTGGATCG
GTGGGGCCATGCTGCAGACTGTAGTATCATACGCTGTGGTCGTATGACGATTTGCCTACACAAACACGTGGTGCCCAAACTATTCCTCTTTCTGACCGCG
ATGGAAGAGATTCACAATTCACCACTAGTCCGTCTTGGAGTGGTGTCTGTATGCTTGTTCATGGCACTCTTCTCCGAGACGATTGGACTCTCGCTTGAGT
GCGCGGCTTTCATGGCTGGGCTAGCTTTGTGGACGTTTCGGGCAACGCAAAGGGGGCCTTCATGTCGATTCGAGTGATGGAAAATCTCTCTGGTAGCATG
TTCTTTACTAGCGTCGGCATGGTCTTGAACCCGATGTTTTGATCTGGAACGCCGGCGAGGAGTTGTCCATAGTGCTATTGATCGTGTGCATCAAGACATT
GTCCATGACTGCCGTAATGACATTCTTCCGAATCGATCCACGAAAAGTGCTAATGGCTGCTGTTGGTCTCTGTCAGATTGCCGAGCTGGCACTCATTTTT
ATGATCAAGGCCCACGCGTCCGAGCTTGTGTCCCGCCGGACTTACTTACTCTTCGTAGCTGCTATCTCGGTCTTCCTAGCGTGCTCATCCATCTTCAACC
GACGAATAGTTGTCGCTCGTCGAATGTCGCATTACCGATTGCCTTCGATGGTCGAAGACAAGCCAGTGGATCGGCAGCGGACTTCACGTAATTACACGGA
CACCGTTTGTGCAGCACAACCGAGTGATGTGTGCATAGGTTCAAGTGGAGAAGAGGATGCAAGTTCTCTGCCGTCAAGGACATGACAACAGCATCTACAC
CGAGAACCCGTGGACCATTAGAATCTTCAATGGTTTGTAAACGTTGTCAACTCCAATGATCGGAGACTTGAAAGGTTGCCGTCAAGAGAGTTGCGTGAAG
TGTTGATTTTATTCTACCATTATATTGCGATGATGACGTCCATGGACTATAGCTAACGTCGACTCCATCGCCTTGGTTGGTGTGAAGATCACACTTTAAC
TTTCTTGTCACGTATTCCACATTGCTACCTTTGGCCACCTACTTGTATCGGGTATGAACTCAAAATTTTCATGAGGAGACATCGCGGCCACAACAGTACC
GTTTCATTAGTCACGCAGCTTGTGAGGCGCTGATGGCAGTGACGGCGTTGAACTTGTTTGCACCGGTTGACTTGCGACACAATGCTGGCGTTGCAACGTA
GTTTGCTGGAGTAAGTACTCGAAACCATCGCGCACACGCTCGTCCGAGAACTCGAGATGAAATTCACGGAATCGAGTGTACACTGATAACACGCAGGCCA
GATTTACGGTGCGTTTGAATGAAATTGGCAAAGCCAAACCGCGCCCAGCGGA