Description :
From Genome Similarity Track
Location :
Scaffold_35:20906- 23110
Transcript NameFunction/comments
Phymu_g2075hypothetical protein

Sequence
2204 bases(100 bases per row)
GCCCACTCTGGAGTTTCAATCCACGGCAGTTCCTCCTTAAACTCTTCGTCGGTCAAGCGTTGGCCTAGAGGCGTTGTGAACTCGTAGCTGCTGAAAAGCG
GACCGGCATACATCACCTTGTTCACGATAAAGAACCCTATGACCGGGTCGCCGACACCCAGATGCAGCACACGTCCACGGTCAGCATAATCAGTGTGGAC
ATCCACCGCCAACACGTCACTCGCGCACGACTTCGCCCTGGAGCCGTAAAATAGACTCGGGTACCATCCTGTGTACGTCGGAGCCCCACTTCCAAGTTCT
CTCTCGATTATCGACTGCATAAACGTCACTTGCTCTTCGTTTAGTTCCATTCCAGACGTTTGTAGTACAGCGATCTCTTCTAGCGTCTCCATCGTTGACG
CGAACACATGAAAGTTCGATCTGCTGCGAAAATCGCGTAAATTCTGTGCGTCTTTCTCGATATCGTTCATTCTTAGCGCCATCTCGCGCATTCGTCGCCA
AAACTCCGGATACGGGTCAACCATACCGTCCGGAAACTCACACATTGGTCGCATTCCACCACTCTGCTTTGCGTACAACACAGTGTCGTGCCGTAGCTGC
GTGAACGAAGCGATTTGTGTGTTCATTTGACGACGCTGCCAAGTCCCGGTGTGAAACGTGCTCGATCTGTTTGGGGATGGCGAGGAAAGAGCTCGGAGAG
CCGAAAGCCACAATGTGCTTACGCTGGCAGTCGTCGCAGTAGACTCCTTAGCGAATTCTTCATCCATAATCTTCCGTAGCGCCACAAGATTCGAGGAAAA
GGGAATTCCGTCGCGATGGAGCACGAACTCGTCCGCATCTGGAGACATTTTCATACGAGCGACAAGCTCTTGGGCTGCTTCGTTGTTCCCGAACAGGGTA
AAAGCAACATCCACCACACTAGGAATGTATCGCGGTTGCTTCACTCCGTCGTGCACAACTTGGCCGTCAACTAGTCGGGAAAAAACGAACGCGCTCCAGA
CAAAACGCTGACCAAGCAACGCCAATCAGACCAAACTTTGGTCTCCTTGCTCTTCGGTCATCGAATCAAAAGCACTAGGGATCTgtgaggctgaagagct
tTCAacaatctgctgctgaagttccagcagcaaatcCTGTCTTTCTTGATCGCCAAAAGCGCTCGGGTTGGTCAACGTAGCCATACTCTCCGGTGAAATA
AACTGCGTAAACTTTTTCATCGACAGTGAATCAGCCCCAGAACCAGCCAGAGACGACAACAGCGAGTCAaactgctggacgtcgtCTAACGTCTCAGATT
CCCGAAGACAGCGCAGCAAGATCACACCACAGAGCAATTGATGGAGGTCGCCCATACAAAAGTCCACTATCCCGAGCCACATCATGGCTCGAAAGTAATT
CTCGAGTGACTTCGACTTGATGTAGTGTCCGCGGGGTTTAAACAGCGAGAAATCAACAATGCGTGGAGTCGAAAACAACTCCACATTCGCCAATCGCTCG
TTTAAAACTATGGATCTCTCAGCTTCCAGGTTTTCATACCCGTCCTCCAGTTTCCCTTGTagcaagctcaagcccaTGGCCAGATACTTTTCCACGTCAC
TGACAGCCTTTTGGACCCTTTCACTTTGGTTCTCAGTTAAGTTCGTACTCATCTCTTCACATTCAGAAAGACTAGCCTCCAGTATCGTACGTAGTGCTGG
ACGCAAACACATTTCCTCCATATCCACCACAAACGCGTCGTAACTGCGATGCCACGCATGCAGAATCGAATCCGACGTCACAAACACCGGTAAGTCCTCC
GAATACAACTTGTAGTAGATGGCCCCGAAGCTCCCATGCATGAACCGCTCACTGGCAATGGCCCCAGTTGCGGCCAGTctttccttctcctctggCTTAA
GACGGAGGTCCAATCGACGGTTTTGTTTGAGCGGGTGGTGCTTTCTGGAGTGTTTTATCTTCGACAAAAACGCTGCTCCATGTTCCAGCTCAGCCTCTTT
GCGCTTTTTCTCCATCGCTGCACGCGCTTCAGCCGGGTCAGTATCAAAGAGGTCGAAGTACTTGCAGTTTTTCAATCCAATCGGTTTGGTttcggaagag
gaaggcAGGGGAGGatacagctccagcaagtccTTGCACTGCAAATGCGTTCCCGTTTCTTCCAACGCTGTGGCGAATGCTTCCGCTGCGCCCTTACTAT
TCAT