Description :
From Genome Similarity Track
Location :
Scaffold_400:20903- 25031
Transcript NameFunction/comments
Phyta_totarag7941phospholipid-transporting ATPase, putative

Sequence
4128 bases(100 bases per row)
GAAGTCGAGTTGCGCATGGCCGTTGAGATGGCGTCCGAGCGTGGCAACGAGTTCGAGGCGATGTACGACTCGGCCAAcgtcgtctcctcgtcgCAGCTGA
AGGCGTAGCCCGTGTTGCGTCGGCCTGTCATCGGTCGGAACATCTTGGTCGGGATTCGCTCCCCCCACGCCGCTTCCTCCGAGATCGACTCGCTGAATAC
GCTGGCTGAGTAGCTCTCTGTGACTCCCGAGCTGGCTGATACTGCGGACGTGCCGGTCGTGCTCGagacgctcttcttcggctgctgctcatACAGCGTC
GCCGCGAagttctggtggtgctgagCCTTGAGGATTTCGGCGTCTGAGTGGCCGAAGTCGCTCAGGTAACCCGTGGTGTGGACGTCGTCCAGGGACATGG
ACAGCGTCTGCTCCTCCACGTGGTTGATAGTTAACCGACGCTGGTACTTGCGTTGTGAAGCACCTCCCATCGAttcctgaagaagctgggcCAGATCTGG
ATGAAATGTTCGCTGGTACAGGTTGTACGCAACGTGGCGCCCGAGTGCCAGCGAGCACCCCATGATCAGCACTAGGAAGTAGCCCCACGTCTTGGCAGTC
GGGGCAAACGCACCGAATTCGTCGTACCCAACCTTGAACGTGGCGAAGTAAGGCGTCTGTGTACCCAGAGCCGCGAAAGCAAACCACGACATCACACTGC
CAAACCACAATGAGAAGGACAACACTGTCCATCGGTCTGCGATCATCCAGATCTTGATATTCACGATCAACACCGTCAGCGAAAATGCGACCATGCCGAA
CTCCACCCGAGACTCGCTGCCTGCCGCCTTCTCCGACGCGTTGAAGCCGTACGACATCACCACGAAGATGATCAGTGACTCGTAGAAAGCCGCTGCGATC
CAGCGACCGAAGGTGTACATGTTAAAGAAGAATCGCTCCGGGCCTCGACGGTACAAGTCAGGGTACTCGATGCTGAACGGCGCTGGCAGGTCCTTGTCCA
GCAcacccaccaccacgatAGGCAGACCCGTGAAAGCGACGTTGTACAGCTGGACACCGATTTCCCAGTACATCTTCGAACCAGAAGCGCCCGAGAGGTA
GCCGTACCAGTACTGCGCCAGGACAAGCGTGATGTTCTTGTAGAACATgtacagcaccagcttggAAATACGGATATAGTTCCACCGTCCGTGAACGAGC
AACAACCGTTCGAGGAAGCGGAATTGCGCGATGGCGTAGTCACTCGAGTTCACCGCCTGCATGCCTTCCTGTCCGGAGATACCCACACCAACATGAGCAG
CCTGGATCATGGCAACATCGTTGGCGCCATCACCAATAGCTAGAGTCCGTACTGTCTTGATATTGTCCCTGACAAGCCTCACCATCTCTGCCTTTTGAGC
AGGAGACACACGGTTACAGATCACCGCGCGGCACAACTTTGCAAAAGACAGCAGATGCGGCGCAGTTCCTGGCCGAAGGGCCATCTCCAATGCCTCGCCG
TCGATAATCAACGAGCTTTCCTTGTCTGCCCCACCTGCCATACCCTTCGCATTATCCAAGAACTCGCGAGCTGCTGTATTCAATTTTGCGCGGAGAGTTG
CTTCATCCGGACATGTGGTGGCGTTCACAATGACTTGCTGGATAGAGTTGTCAAGCAGTGAGCAGGCGTACGAGATGTTAATTGCAGTCTCTTCCTTGTC
GCCTGTAAGCATCCATACTTTGATGCCCGCTCGAGTCAAGTTTGCCAAGCACTGCGGAACGCCATCCTGTAATTTGTCTTCAATAGCCGTCGCTCCAATC
AGCTCCAGGCCCTCCTCGATTTCTTCCATCAGATCATCAATAGCGTTTGGTTTACCATCTTTGCGTCGGTCGATCTCGGCCACGTTGCCTTGTGCATCAT
CGAAGCGCATCTTCCACTGATGGAACCAGCGCTCATCAAGATTCTTCACTGCAAGCGCCAGCGTACGCAAGCCATCGTCAGCGTACTTCTCCATGTGGTC
ACGTGTGAtgttcttgagcttcagcatcgctgGATCATCCTTCAAGCGCTGATAAATCATCATGTCGGCTCCCTTCGTGTAAAGAAGCAGCTCCCCGGTT
GGTTTGCGCACCACAACAGACATCCGCTTTCTCGTACTGTTAAACTcgagcacgtccagcacctcgtagGTTACGCGTTTTCCCAGGACCTCCACATTCG
CCGTTCCAACGCTACGGCTTTCGAACTTGAATCCTGCAAAGGCTGCGCCAGCCACGAGAGCCTGTTCATCAGGAGATGACGCGGAGAGACGAACTTCACC
AGATTCCAGCTTTTCAGGGATCACCGTGTGGCACACGGCGAGGTGCTCGAAGAATTGCAGAATCTTTTCCATCTGCTCTTCGCCTGCACTGCCCTTCATG
CCGTCGAACAGTGATTTATCTACAAAGTTCACAAACgggatcttcttgatgctcgGATCCAGCTTAGGCTCCGGCGGAATGGGCTTTCCAGCACGAACCA
GCGCAGCGCGCCCAATTTCTGTGAGTCCTGAACCATACGAAGTGCCGTTAATGGAACACCTGCGGAACTCCATGACGTTGCAGGTTAGCGTGCCCGTCTT
GTCACTGAAAACGTAGGAGATCTGGCCCAGTTCTTCGTTCAGTTCCATCGTTCGCACGATAGCAGGCGTGTCCGTCTCAGCATGGTACATTTCGAGGTCC
CACGACATGAATCGTGACTGCAAGAACTTGACACTCGTCATGGACACGTACAGCGAGATGGGAATCACCTGGTAGAGCAGCAAAAAGTAGTAGAACATCA
TCTGGATAAACGCCACGAAGCGCGAGCGGTTCCTCTCCGCCTCCGTGAGCTGAATGTACCACGTGTTCCGTACAATGTCGTATTGCCACGTGATGTAGCA
AGAagcagccacagcacaaGCCACGAACAGTCCCAAGCACAGCATAACGATCATGCGGTTGATGTTAAGCATGAGGTCGCTCCACTTGGACGGCGCTGCA
CTGGCACTCTGCATGATCTTGGTGTCGTTACCCGTGTTGAGCACGAGTGCGAAGACCCAGTCCGTGTTACGCAGGTTGCagccgcgcagcagcacgttct
tgACCGAAAGCGGCATGACCTCGACACCGCAGCCGTCACCCACCGTGACCTCCACTTTGCCAGCAAATTTGTTGATGTGCGGGTTGGGCTGCTCGCATTT
GATGacaccacgcagcagttccagctccgCCGCATTACTCAGTGAGCTCATCGTTGCGGCTACCGCTTGTCGCAGCTTGAGGTTCGTCTCGCCATCTAAA
CTCTTGGTCTCGACGTAGCAAATGCCGCTCGGGGGTTCACCTACAGGCTCTGCCACcgcgagcaccagcacatcaGCAGGGATCACTTCTCTGTTTCGAA
TCTGCAAAAAGTCTCCGACCTTGATGTCCGCCCACTTCCTGTCCACGACCTGTCCGCCCTGAAACACGTGGCACGTGGCCGAGTTGGCTTCATTGTCGGA
CTTGTGACGTCGCAGGTCCTCCATGACAGCGAACACGGcgtcgatggagatgacgaagaacaGCACTGGCGCGTTGGTCGGGTACCCGTACGTGTTACTG
ATACTGGGGATGCTCTGCAGCACGCAGACcatgaggaagaagaagttggccACTTTGGTGAAACTCTCCCTCAAGAACTTGGGCAGGAAGGTCACGAGCG
AGTACTTGGACGTCACGACGACGTTCGAGCACTTGTCGAAGATCGCGTTGCCCGGCGCGTAGTTGAAATACACTTCTCTTAGCGCCGCGTCGTCTGCGTG
GCCTCCTGCGGCTCCTGAATTGACACTGCCGGCTGTGGATGCCGGCGTGTGTTGCGACGCGTAGTCCACaagctcgtcctcgtctaGAATCTGCTCAGTG
TCGCCCCTGGTCGCTCTTCTGCTCTTGCGTCGAACCTGCCGcggcgactgcagcagcgccggaCTGCCCAGCGTGTTGTAGCCGCTGGTGCTCGAGCCGA
GAACGCTGTCGCTCTGgtcggacgacgagatcgagtCCCGTGCGGGCGCCACGCTGGCACACAGCGCCACCTGGTCCTCCACCCGCGAGCCGCGGAAGAt
gcgcgacgtgctgcgCTTGGCCGCCATG