Description :
From Genome Similarity Track
Location :
Scaffold_258:20900- 23289
Transcript NameFunction/comments
Phypl_g6072conserved hypothetical protein

Sequence
2389 bases(100 bases per row)
GCTTTGCTGCATAAAATACCCGTGggcaagctccagcaccttcacccACTTGAGCATGTCCTCGTGGGTCTTGGCAAGCATTCGTGTCTGTTGCGTGGGC
GAGCAGATCATAAATTCGTTCAGCTTGCCCACTTCCTTGCCGTGCAAAATTTCCAGCGACTTGTGCTTCAGTGGGATCGCACCACGCGGCTCGCGATCAC
CCTCCCGCTTGTAGTATCGAAGGTATCCGTCGGGCTCGATGTTGAACCACCTCTCACGAACACCACGCAGCGACATGTTGCCGAATGCGCCCTTTTCGTT
GGAGTGAGTCGGGTGCTTCCGAAGGATACCACTCATCGTCGGCAGTGTGCCATCTCGGGGCATCCGATTCGAGTTCGAGTCGTACGATTGCGTCAATGAG
GCCATtgactcgctgctgctgcttcggcggCTGAGGTTGGGATCATATCGCTCCGAAGTTCTCTGAGCGCTCGTCGAAGGTCTGCCGCCATGCGAGGCCT
GACCACCACCCATGGATGCCCTATTGCCGCTCATTGAGCCGCGGATACCACCACCAAGTGACGCTCGGGAGCCGCCGGTAGACCTCCGGGGCGCATCCTG
GATCGTCGGCGGACCAACTACAGACGGTCTCAAGTACGGCTCCTTATTCTTGACCGCTACGTTGAGCGTTCCGTGTGTCAACACTTGGAACTGGTCCTGC
ACTACCTTCATTTCGTCCTTCAGCTGCAATCGCCGCTTGCTCAGCTCGTTCTTCCGagcctcgtccttctcgccTGCCGCCTTCGCAAGCTGAACAACAG
CTTCGTGCAACTGGGTTTGAAGCTTCGCCAGCTTTTTATGCAACCGCGACGATTCTAACGTGCGTTCGTGTGGGGCCTCGTCAATGTTAACAGTGTCGAT
CGACGAATCGGCGTGCTGCAACTTCACTTGTTTACCTTGATCGACGTCAAAGAACACGTTCAGCTCGTTCTCCATTCGCCGCATCTCATCGAGTGCCGCC
TTTAGGTCATCCTTCAGGTCTGCTCGTCGGAGAGACAGGTTGTCGGCCTGTTGTTGGTCACCGCTATTCGCTGCTTTTGCCATTCCAGCCACCGTTTCCC
GCAGGTTTTTCCGCAGCAAAGCGATCTTGTTCTCCAGAAAGATCATTTGAGGCGGACGCTCGCCGCTAATGAAGGCATCCTCGCGCTTGACCGCCTCTGT
TGCCACGtccatctgctgctgaaaCTGGTGGATCTCTGATTCCACAAACTTTgtgcgctcctcctccatgttGATCTCTTCTTCAAGATGATCTTGTTGC
GACTTAATCTTCCCGAGAAGCCGCTCGCGTGCGTCCTCAGCACGAGTATCGATTGAACCTCTATGCACCATGGAGCCCAAAAATGCCGGCGAAAAGAACT
TAATCTCATGCTGGCCATTCGGATCCACGTCAAGATCTCCGTATGCGTCCAACTCTTTCTGCAGATCATCCAATGTCTCCTCAATCTTGACGCGTGACGC
CTGTAGTTCGTCGTTTTCGGCGATAATTTCAGTAActtccttctcgagctccgctGTTCGCTGGGCAAGCTCTGCTGTCCTCAGCACTTCTGGCGATTCA
ATTTCTCCGGCCGCTTGCTTATCCAACTGCTCGATCATCACCATGAACGAACCTGCTTCTTGGATCAAGTTTTcacgctccttcttcagaGATTCTTGAT
GCTGCCGCCCCCCCTCCATTTGCATCTCCATTACCTCGCACTTATTTTCCATCTCAAGCATCTTAAAACGCatgtgctgcttcgtcgccgcccaTACTTG
CTTGTGGAGTTCGTACGACACCATGATCTCGAAGTACTCCGCACGTAGCGAGTTCTGCATTactcgtgctgcgcgaacCTCCTTTACTTCTTCCGTCTCT
TCGTGCGGAATTTCTTCCTCGACTCGGCCCACAATGCCTTTAGAGATATCAGCGAACTTGATGCGGACAGGACGTATCATTCTAGcgagcagttccagca
cctccGAGTAGGTGTAGCCGGTCAGCGAAATGCCATTCATCATCGTCACTCGCATGTTCAGTGCAAGACGCTTTTCAGGCTTAACACTCCAGTTATAAAT
CTCGGCGGGACTGGCCATTCCATTCGGCAGCTTGTAAATCTCCGCGATGTGGACCTGAAGGTCAGTAAATTCTGTCCCAGGGATACCAGCAATTTGCTTC
AGGTTGAGCCCCAACCGGCCTGGTCCAAATGTCACCTCGATCTCATGCACCCAGTTGTAGATGACACCAGTTTTCATGGGAGGGCGCAGCCACTGCGTGT
GTCCGTACGGCGATACATAGTATGTCCTGCCGTCATTAGTTTTGCTCTGGCGAATGGACCATCCCTTAGGCAGGGCCAGAATCTCACCG