Description :
From Genome Similarity Track
Location :
Scaffold_227:2090- 5349
Transcript NameFunction/comments
Aphas_H257_18813endonuclease

Sequence
3259 bases(100 bases per row)
GTTGGGATAGGGACCCGCGTTGGAGATGCTCTTATTCACTCGAGCATGTACTCCGAGATCGTTGGAAAAGTACATTGATTCAAATTGCACTGTGGTCAAA
TAAGGATACCTTAAACGATTGTACATATACTGTATTGATATTTTAACTAATACGTACAAAGAGCTCAACAATCGATCGGAGGGAACCACAACAAACACTT
AGCAGTGGTCATCGGCCACAGCGTCCTTGGGCAGCGAATTCTTAGACCTCAAGTGAGGGACGATTTCATCGGCCACAGCGTCCTTGGGCAGCAAGTTCTG
AGACCTCAAGAGAGCGACGATTTTGGTCATCTTGTTGCCGGTGTTTTTACCGTTCAAGTGGCACCCCCAGCAGTTGTGCAACGCTACAACCTTGTTGTCG
TGGGCGCCCAAGACGGGGGAGCCTGAACTTCCGCTTTCGGTGTCGAGATTGTACCCCAACGTGTCTTGCTCGTGGCATACCGAGGGTGTGGACGTGCTGG
TAACGCGAGCGTGCGTGCCGTCGTCGTGCTCGAACGTAATGTGTTTCGGTTTGCCAAAGGGGTGGCCCAAGAGGTAGACTTCTTCGTCTAACGAGGCGTT
CGCGGCGCGGGCTTGCAAGTACCCGTACTGGGTCAAGTTCACACCAGGGTTTAAGTTCAACTTGAGCAACGACACGTCCAACAATTTGTCCGTAAACACA
AGCGTTGTGCTGTCGGCGACAAACGTTCCAACACAGCCACCTTTGTCATCATTGCTGGGGTCGGCACAAGTCGAACACTCGGAGCCAAACTCGACTCGGG
CCTTGTTGGCAATTTTCTCGTTCCGGATGTTGTGGTGGTTGGTGACCAAGTGGCCTTCCGACCCCCACAGCCACCCCGTGAGGTATAAGTTCCCTAAGCG
AACACGAGCCACAGCTTGGGCAAGTTGATACTTGATGGGATGGGCATCGTTCAAACAGGGGGCCGCTTGAGCTTGGTTGGCAATGCAAACCGACTCTTCA
AATACGTTAAAAATGCCATCAGCCGATGCCACGGCCACAAGAGCAAGGACTGCAGCAGATTTGAAGGACGAGAACATGCTTGACACTGGGGGAATTCAAA
AATGGGAAACACGACCATTGAAACAGTATTTCGAGGAAAAACAACAGTGGAACTGCTTTGATGAGGGAATTTTTCGGTTGACAAGAGGTGCATCCCGGGA
AACCATATGGAGTACTCAGGTGTGCAATTGTATACTCGTACCGCTTACCATCTCCTCTTGCAATTTTTCATCATTCTGGTAACATTACGTACAATTCCCT
CAATAAAATAGTTCCACTGTGGCTTTTCTCAGAATACACTGTTTATATGGAACGTTGTATGCTCCAATCGCCTCACCTATTACCGGTACTGTACTATTAT
AGGGGATGCATTTCAGTAGACCTCTAACCCAGAGACTGAATGACTGACTAGACACAAAGTAGTTTTTCATATTCTCATCATTCAAATAGAGTGCATTCAA
ACTGACAAATACCCCATAGTTCGCCAAAAAAGAAAGATGTTTTTGTAATGTAGTGACCCTTTTCCAAAAAGAGATCGAGGTATTTCCAATGGTCAATATT
GAAGAAATCCGATTTCTTACCTAATTGCATTACTTTGTAAGGTAATTCTATGAAGTGTGGCCAGCTTTAACTAATAAAACTCGTTATATTTGACTAAAAC
TTAGACAGAATTGCACAAATTCAGTGCACACGCCTAGGTAGAACAAAATCCTAAAATGCACCCATTTTTGATTGCACCAAGTTGCCACGTTGCAAAACCC
AGTACAGTACAGTAGACCTCAGTCAGTGCATGACTAGACCTCGTGACGAATGAACAAGGCGCCAGCTGTAAGCACGCCTTGCATAATGTTGTAAGCCTTG
ACTAAGTGTTATTTCGTTTTTTGGTGATATTCTTGAGATCAGTAACAACAATGAAGTCTACGATCATGCGTGCCACTCGCAAAATAGATTAACGACGTGG
TTGTTGTCTGAGGAGTCTATTTCGATTCGTAATGAGGTATTGTGAGGGAATACTTTCACAACTGTCGTGTTTTGGTCAATTTCGTGTTTCACCAAAGTTT
ATCACCGTCACAGTCATCCACAGTCATGACTTCAATTGTCATTGAGACTCTGTTCAGGTTCCCCATGGTTCTATTTTCGGGGTTTCGGGGTTGCGGGGTT
TCGGGGTTTATTAGGAGATTACTGAACGTTCTTGTGCCCAATCAGTGTTCTTGGAAAACATCGAGTGATTTCCGAAAATAGTGAATGACTGATAAATCAT
TAACGTACACGAGATGATCGAGGGACCAATCCCATAATCGATCGCTGCAAAATGACTCATATATTAGAACCCGGATGTCTGACCAGTCATGAAAGTCCAT
CCAAGAACACATGGGAGTACTTGGAATGTAATTGGCCACTGACTGGAGGCTTGATCATACGTCAGGAGGTCTAGTAGTTAGCGATAGCTAACCCCTCCAC
CTTTTTGCGGAGAATTTCAGCTTTTTTCACTACATATCGCTTAACTTGGCACATACTAGTATCGGTTATCTCCATTTACTATTTCACCAAGCCAGCGGTA
TAATTCGACCAACTATCATATAATTTCACTTTTCGCCAATATATTTCACCCTGCAGCCGATATATTTCGACCGTTATTGTTCTCTGCTGGCACTTGATTG
ACGGTTTCGTTTTTGCGCGCTTCCACTTTTCGAAGCTTCATTCAGAAAGGCACTCGCCACCCCCGCACGTTGACTTCTTATACTGTACAACACGAGGTAA
GCCCCTGTCGCGCCGTACTGCATCTGTACTGTCCTTGCAAGTGCCTCTGATATGTACTGTATGTTTGGGCGGCCTGTACGGTAAATGAACCACATGTTGT
GGAACCGCTTCGCCGGCAAGACAGGAAAAGCATTAACCCGCTAGGATGGGATGCTAAGTGCAAGTCATGTATACTTAAGCAATATATTGGTTAAACTATT
CTGTACAATATTGCCAATGAGAATATTTCTCATGAGCAAGTTCAACTTATGAGTAATAATATACTCAGAATCGCTATTTTTATTCAGTCCATCATTTTCC
GATGAGAAAGTTTCTCATTGGGCGAGCCAATTAATTGCCAGGACTATGTACGGATATAACCGGAAATAGAATCTATATATACAGTAGACGTATCCGAAAT
GATACAATAAATAAAGTACGTTTCCGTACGTATCGAGTCATAGTCGAATTGTATTGCAA