Description :
From Genome Similarity Track
Location :
Scaffold_1040:209- 4556
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1040-snap-gene-0.3YALI0B04708p
Pytap_DAOMBR444snap_masked-pag1_scaffold_1040-abinit-gene-0.8Aspartyl protease family A01B

Sequence
4347 bases(100 bases per row)
GTTACGGCAGTGAAGAACATGCTACAGTATGTGGAACTCCGAACTTTATTGCACCAGAAGTGTTGTGGCTGGGgAATCGTCTACTTATGATGAAACTGTG
GACATTTTTTAGTAGTCATACTCAAACGTCATGTTCTTGAGAGCAAAAAGCAGATAACGATGGAATGCGCGGTTCTGCTCGATCAAGCGAATAGCGCGGA
TCACGCTCACTAACAGGGGCTTTGGCTGATCATTCATTTCACATGGATGCCCGGATGTCTCCATTGCCACAGCTTCTTCTATTCGAAAATCCTGGGCGCG
AGTATACTCGATCTCCTCCGCGTTGTGCTTGCACCACTCTGTACACCGTTCCACGACCAACAGTAGCTGATCTACCACATGTGCTAACTCGCAATGCCGT
TTGTTTTGTGCGATGATATCATGAGGTAGGATGATGCTGTCATTCACATACACGCGGAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGGTACCCAAcGGACGGCACGGATGAAGAGAGGCGCAGGTTCATCGACGAATGCTGTGCCACGGTGCCCTTTCACTTGATCTGGTGCCCGGAGCTGT
GGGAGAACGACGAGGAAGAGTTGAAAGCGGAGCAGATTGACAACACGGACGATTTCCAGAGCGGCAACGAACGGATGGAGTCATACGGCCAACTCACGTG
GTATTTCGAACTTGTGTTGTTCAAGGAAAGCATTCGTGCCATGACACCGGAGACTTGGCAGGCGGTAACAGATTTTGAGCTTGGCACGGACGCTGCTGTG
GAGAAGACCAAGtCATTCTTACTGGATGTGCACAGTGGTGCCGTGACAAAGGCGACATTCCGAGActATTGTCCCGAGGGCGATTTGCGTCCTCAGATCA
TCGATGCTTTAtGGGTGCATGTTGAGCGCATCATGAGTGAACTATGGGATATTCGTCAATGTATCATCAAgaCGCTTGAGAaGgTCATCGAGAACAACAa
GTTGGACGCTGAAAATGTCACCGAGTTTGTCTCTCCAGGGCCGGTGCAGGAGACATGGATGAGCGATCTTGCAATTAGTGAAGAGGTCAAGCAGAAGTTC
ATcaGTGAGGTGGCAAAGCTTGAGAACGCCCCAGATGAAGCAAAaGACTGGCATCCCCATTCGAACCAGCAAGTGCTCGACCTTATCCACCCATCTCTCT
TCTGTTGCGTGTTCGGCCAAACGCTAGCTCTCGAAAGTGATCCGGTGGATATCGTGAACGAACCACTGATGAACGGGAGCATTCCTCAACGGACTCAACG
CATGGCATTTTGTGGGTCTCGACTTGTTGAAAACAAACACCGAGGATCAGCGCAGTACCAGTGGATACCCAGTGACTTCAAGGTGGCAGCGAACGGTGAT
GTCGAGATTATGTCATACATCAACAACCTCCACCCAGTCGAGCACCACGCTATGTACGCATCCATCGCCAGCATATTCAAGCAGTTTGTTCCTATGCTAG
ACCGGGTGTTGTCCTGCCTACGCAGCCCGACAAGCCCACCTCTCTCTCTCGAACTTCCTGACTGTGAGCGCGAGACGTATGAGATTCCGCAACATCCAAG
CATTCCCGAAATGCTACGTCTGCACCCCCCcGGAACGCCTTTCTCACTGAAGGGTCGTACAGTTCAAGTCATCGTCAAGGTCGCAGAGATTCATCTGACA
CCAGACAACCCAACGTACGCTGGTGGCACGTGGCATGTGGAGGGCTCGGACGCCGAACAGATCGTTGCGACTGGCATTTACTACTTTGGTTGCGACAACA
TCACCGAGTCGAGACTCTCTTTCCGTGTGATCGTTTCGGAACCGTACTACCAACAAGACGATACAGTGGGGATGGCAGCCACGTTCGGTCTTCAACGCGA
CGAACGGCTTGTGCAATACCTGGGCTCCGTAACTGCTACTGAAGATCGATGCGTCGTGTTCCCGAACACGCTGCAGCATCGTGTGGACCCGTTTGAGTTA
ATGGACAAGACCAAACCTGGCGTGAGGAAAATCCTTGCGTTTTTCATCGTGAATCCAGCGATTCGAATCCCTTCAACAGCGGTCATTCCGCCTCAGCAAC
TCGACTGGCTCAAGGACGCAGGAGGCCCCCTTCTCACCCCCTTACGCCGACTGCCTGAGGTCGTTCTGGAGAACGTGAAAGACCTCCTTGGACGAGGCAT
GAGCCTTGTGGAGGCTAAGCACCATCGCCTCAAGCTCATGGAAGAACGCAGGGCTGTGGAGGAAGCGGACGAAGACTACGAACTCTTCTTCTCTCTTTGC
GAACATTAACAGTGCAAGCACCCTTTTTAAcTtCAACTTGATATGTCTACTAATCTAGTACATCTCCCATCTAATCCCACCGCGGAGGTACTATTGATGA
TATCGCAGTATTGTTGTATTGCACTGTAAGGCAGTTAGTTACACTCGTCCTCGGGATGTCACTCACGCGGGGTGGCGCAGGTTCAGTCGCGCCATTTTGA
CACGTGCGTCGCCTGCGGCCCGCGGCATCCGGCCATTGCGCCATCTCATCGCCTCGCGCCCGTCAGACCGAGAGAACCGCCAGTATGGTGCTCGTGTGTG
GACGCTCGGCTGCAGTTATGGCTGCGCTCGTGGCCGTGGCCGCGACCGGAGCTGCTGGCTCGACGCAGGCTCCCGGCGGCATGTCACTGCAGCTGCACCG
CGTCCCGGGTGCCCCCAAGCACCACGAGACATACCAGCGACGTCGCCTCGTCGGTAACGGCTATGAGGTGGTGCCGCTGAACCCGGGCATGGGgTGAgTC
GCATGGTGGATGGTTTGGGTGTAAaGCGAGGAAaCTGACTGTGGAAATGGCAACCCCAGAACTCACTACGCGTGGGTGTACGCTGGCACACCTCCGCAGC
GAGCGTCCGTCATCACGGATACAGGCAGCAGCATCATGGCGTTCCCTTGCTCTGGGTGGGTGACGCGTGATCCGATTATGATGTCGCACACTGACGAGAT
GTGTCTATTAGGTGTGCCAACTGTGGCGACCACACAGACCCGCCATTCACACCCGACAACTCGTCGACGCTGACTCATGTGACGTGCGGACAGACATCGT
TTTTCCATTGCGAAGGGTGTGGAGGTGCGGATGACGAGAAGAAGACGTGCGACATCTCGCAATCTTACATGGAGGGCAGCAGCTGGCAAGCTTCCGTGGT
CGAGGACATCGTGTATCTCGGCGGAGCTGAGAGCGGCAAGGATACCAACATGCGCAATATGTATGGCACACACTTTCAATTCGGCTGCCAGTCGCACGAA
ACGGGGCTCTTCATTACCCAGGTCGCGGATGGCATCATGGGCCTCGCTAACAACGGTAAGATGTCGTGTAGAGCGTGACCTCATGCTTGTAGCTGATATG
TCACCACTCAGATCATCACATCGTGGCAAAACTaTACAAGGAGAAGAAGATCCCGAACAAACTCTTCACATTGtGTTTcGCCCCcGAAGGAGGGTCCATG
GCGATCGGAGCCCCTGaTGTGTCGCGTCACAAAGGCGACATCCAATA