Description :
From Genome Similarity Track
Location :
Scaffold_2045:209- 3090
Sequence
2881 bases(100 bases per row)
TGTTCACTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCCGCGATCCTCCTCCTCCCGGCCCACACCCTTCCTGTGGGTCCTTCATCATCCTCC
CATCGACATGACCAACTCACATCCATGGATCCCCTTACTACGCTTCTTCATGAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCCCGCAAGAA
ATCGTAGAGTAATGCTCCACAGTTCAGATCTGTCTCGGCTACCCAGCTGGGTTCGCCATATCCACTCCAGTACACCAGAAATTCGCGGTAAATCCGTCCG
TATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATCCCAACTATCTTCCGGTAGGAGGACTT
CGTCGAAATTCCACCCGGTGGATTCATCCACCGAAAGACGGGTTTGCGGCCGGTCCGGATATTCCTTGACCAACTTCAGCTTGGATACGTGTACTACAGG
GAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTCACGGCGTGTTCCCCTATCTTTTCACTTACTCGGAGCGGTCCGTGCCAGAGATGGGCCCGCTTA
CGGGCGTATCCTTCTTTCACTCGGTCTAGGTACAGCCACACCTGCGATCCAACTTGGATTTGATGTAAACGGGCGTCTTCGTTGTGTCGATCCACTCGGT
CTGTATGGCACTTCGAAACCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTCTCTTCT
TGGTACTACATACCGGAATGGGCGCTTCTAGGGTAGATTTAGGATCCCACCCATGTACCAAGTAAAATGGAGTGTCGCCCCGGATTCTGTCTTGGGCGGT
GTTCATCAAGAAGGTGAGTCGTTGCCTACTCATCCCAATCCCTCTGATCCATATCCTGAACATACATCTTGAGTGCCCTCGTGATCGTCTGTACCATGCG
CTCGGCCGATCCATTGGCTTGGGACGATATGCCATAGTCACCCGCTGTCTCTGTCCCAGAATCCGGCTGAAGGCTCGAAAGAAATCAGACATGAAGCCTG
GCTCCCGATCATGACGAAGCATCTCACTAGCCCCAAATCTTCAAAAAACGCACTCCTCGTACGATTCGGCGATAATTTGTGCAGTTCTGGACGCGCTAGC
TTTGGCTATCTCGTATCAGGAAAACAGATCCAACCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGTAACGAGGGGATGTGATCCATGGCTATG
ATTTGGAGCGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATC
GTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTA
GTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGACAATAAAAGAGC
AAGTCATTCAAATCCACTGCATAATCCGTAGCGATGATACTGTAGGATTTGGTATCCTCCCGTCTCAGGTCTCTCACATCCCCCATCAGATATTTCTTTA
GTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCCCTTCACAAATGCTTCATCGAGAATCTGGGGGCTGGATCCAAT
CCTTCCTCTGGATCTAGTGACAGCCATTACCTGGACTGTCCTTTTTACGGATCCAACCACCACCACTTCGTCTAGTCGGTTTAACGTGACGAGATCCTGA
TGCTCGGCCTCTCTCTCCACCTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGACATTCCAATCTCGCTTGACATGCACCA
ACTCGTGATTTATCCATGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTACAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGCTT
GAATCCCCACAAATCACCAGCCTTTTTGGATCCTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCCT
CCGCATAAGTGGATCTGGGGCCCGTACATCTTCTCATCCGGGCAGTCTCCACAGTATTGGACTGTATGTCTCCTCCTCCGCGTCGTACGCGAGCGGATTC
ATCGAAGCTCAGGACGCTACAGATTCTCATCCACTTGTACCCGTCGAGATCTAGGGTCTGGATCTCGGCGTTTGGGCTCTTCTTAGGAGCGATCGTAGCC
AGCGCTTCATCCATCTTAGCTCTAGGTGTGATGCTCGCGGCAAGACTCCCAGGACCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGC
GAGAGTATAGCTTCCCACTGTCCCAAACGTCCTTGTAGCCCGGCCGACTTGAACAGCCAAGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTC
CCACCAGCAGGTTGTAATTGAGATCTAACACGCGCAGGAGCGCGAGTATCTCCTTCTCCGCCGCTCCGTAATTCAGTTCATTTGGCTTTAGCGTCCGGCT
GACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTATCAAGGCTGCTGAGACTGCCCAGTCACTGGCACAAACTATCACCGTAGGTTGACGTTCC
GGATCGAAATGGCGGAGGATAGGCGTAATCGCGATCCTGTTCCTTAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGA