Description :
From Genome Similarity Track
Location :
Scaffold_1226:209- 2286
Sequence
2077 bases(100 bases per row)
GCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGATTGGCCGTGAGTTCCTTGTGAGTATTCA
GCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTG
CGCAATAGCAGCATTGACGCCGTTGATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCAC
TCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTTGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTAC
GGGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAA
GCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGATGCCATTGCGATAGCAGCACTGCGAACTGG
ACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGA
TCTTCAACAGATGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTCCTTAAGCACCCGATCGAGGAACCGTACGGGGTGTAA
CTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACCTCTTTCGACCGATCGAAGTGCCTGAGGATG
GGTGAATGTGAAACACTCGTCTTCAATTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCG
CCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGACTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTC
GGTGATGGCCGCAAGCTTCTTGGGGTCAGCTTTGATGCCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTG
AAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTATCGAAATCCTCGCCACCGAAGCAAATGTCATCCA
CAAACGACCGTCGACCAAATACAGGTACCAACGATGATTCGTCTGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGG
GTCGGTCTCTACCGGTACTTCGCGGTCTGCCGCGAGCTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAA
CGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGGTGGTAGATAATCGGCGCGTTCATTA
ACCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCT
TGCTGCATCCAGCGAGCAGAACCATACGTAGCGCTCGAGATCTGGTAACAGGTCGTCGAGTAGCGGCATTGCATACTCCATAATCGCGGTGATAGCATTC
ACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCATTCTTTTTCATCACAATCACGATCGGCGATGCCAATGGACTGTCTGACAAGACGGTCAGTC
CTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCAAGAAATCGTAGCGGTACGCGCCGGGCACGCTGTTTTAATTGGGGGCGTGCCCCTGTGTG
TCGATATCGCATACCGCACGTTAGCCTGGCCGGCGGCAGTGCGTTTATCACTAGCAATCAGGATGTGCTCGTGTTTC