Description :
From Genome Similarity Track
Location :
Scaffold_2064:209- 1712
Transcript NameFunction/comments
Phyag_g11988copia LTR rider

Sequence
1503 bases(100 bases per row)
CGGCGACGTACGACGAAGTCATGCGCAGCAAGTTCAAGGAGGAATGGCTACATGCGATGGAGAGCGAGATGAAGTCATTGGAAGACCACCGCACGTGGAC
TTTGGTGGACATGCCGCCCGGAAACAAGGCTATCGGGTGCAAATGGGTGTTCCGCATCAAGCGTGACCCCAGCGGGAGTATCGTGAAGTTCAAGGCGCGA
CTGGTGGCTAAGGGGTTCACGCAGCGTCCAGGGATCGACTACACAGAGACGTACGCTCCAGTTGCACGGAAGGAGTCTATCAACTCAGTAATCGCAACTG
CAGCGGAGGAGGACATGGAAGCTGAGAACGTGGATGTGGACACCGCTTTCCTTTACGGTGATGTGGAGGAAGTGATCTACATGGATCAACCGGACGGCTT
CGAGGACCAAGCCAACCCGACGAAGAAATGTTTGCTCGGACAGGCACTCTACGGGACAAAGCAAGCGGCGCGCCAGTGGAACAACAAGTTGAATCGACAC
TTGGAAGGTCAAGGCTTTATCCGCTCGACAGCAGATCCGTGTGTCTACGTTCGTCGGTCGGGGGACAAGTACAGCATTGTCGTCATCTACGTGGACGACC
TCATGATTTTCAGCAGGACGAAGGCTGAGATTGCGGAGATCAAGGGGGAGTTGAAGAGCGAGTTCAACATCAAGGAGTTGGGCGACTTGAAGTATTGCCT
CGGCATCGAGATCCACCGCAAGCGCGAAGACAAGATCATCCTAATGAACCAGCGGGCCTACATCAAGCGACTTGCGGAGAAGTTCGGCGTGGAGAATTGC
AAGGATGTACACACACCAGCGGACAGCAACTCGAAGCTCGTCAAGCCATCGGAGAGCGAAGCGTTTGTGCCGAAGTTCCCGTACCGCGAACTGGTGGGGG
CTTTGATGTACGTGGCGACGTGTACGCGCCCCGACATCGCGCACGCAGTGGGTGAAGTGGCCAAGTTTTGCGAACGCTACAACAAGTCTCACTGGATGGC
TGCGAAGAGAATCCTGAAGTATTTGAAGTCAACACGAGATTTGGGCATCGTGTTCAACGGCGGTACCAAGGGAGAGCTTGTGGGCTATGCAGACGCAAAC
TGGGCAGGCGATTTGGACACCCGACGTTCGACCACCGGTTATGTCTTTTTCCTGAACGGCAGCGCGATCTCATGGAAATCGAAGCGGCAACCGACTGTGG
CGACGTCAAGCACGGAAGCAGAGTACATGGCGTTGTACAATGCGACTCAAGAAGTTGTGTGGCCACGACTATTGCTGAAGGACATCGGCCACGACATCGA
CGGCGCTACAACTATCCACCAGGACAACCAAGGGTGCatcgcgctggccaagaacccGGTGTACCACTCGCGCACGAAGCACATCGACATCAAGTTTCAC
TTCCTGCGCGAGAAGGTTGAGCGTGGGGTGATTCAACTCGAGTACAAGCCCACCGACGAGATGGTTGCTGACGGCTTGacgaaggcgctggcgcGTGACA
AGC