Description :
From Genome Similarity Track
Location :
Scaffold_4068:209- 1418
Sequence
1209 bases(100 bases per row)
GGCTGCATCGATACTCACTCGATCGCGGTCCTGCTGTACTACAGCACCGACTCTGGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGAATCTAAAG
TATCGAATCCTCTACGACGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGA
TGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAGAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCC
CAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGCTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGC
AAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGG
CAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTTAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCATCC
GCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCGAATGCGCCAAAACGCTGGGGCCAGATGCTCCCA
CTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGTGTCCCACTGACGCCGC
CACGCAGTGGCTCATGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGACGCCTTTGTCTCTTT
GAGATGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAAAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGT
TTGAGGTCGGAGACCAAGTTTTATTAAACGCTAATACCCTACCTACTCATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACC
GTTTAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGTACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATAT
CAAGACCCT