Description :
From Genome Similarity Track
Location :
Scaffold_33:209- 1362
Transcript NameFunction/comments
Aphin_H310_14969predicted protein

Sequence
1153 bases(100 bases per row)
TCTTCTTGGCCTTCTCGACAGTCTTCTCGTCTTCGTCGGCAGCGTGCTGTTGGGCAAACTGCTCAATGCACGAAATCGCAAAGTACGCCATGAACGCCAC
CATGATGAACCCGCCGGCCTGCGAGATGAGAGAGCTGCTGTCGGCCGCGGCGCCTTCCGCCGCGTGGTCGACCTTGGCCTTGTCAGCCACAGCGTGAAAC
TTGTGGCGGCACTCGAGCAGGAACTGGGCGACCTTTTGATCGAGCTCCCACGACTCGGGGGTGATGGCCGCAATGAACTTTTCGATCTCCGTAAGCGTGG
CGTCGGTGAAGATGGTGACGAAGAACATCGCTTGCAAGTTGGCCTTGATCAGCGCCTTCCCGATCAACGTCGCGCCGAAGAACGTCCAGAACGGCATTTG
AAAATGGCCGCAGCAGATCCCGCACAAGTCGAACGCCATGTTCGGCCACGCGCTCATGAGCAGCACGCCAAAGAATCCATGGCGTTGCAAAAACGAGATC
ATCCACTCCTTCATGTGGTTCAGCGCGTTGTACTCGGAAGACGACGTCTGAATGTCCTCAAACTCTTCGTTGCGCTTCCCGGCCACACTCGCCGCGTACG
ACAGCGCGTACGGCGGAATCTCGCCCAACGCGGTCCCTGCACCCCACAGCATCGACGCGACTGCGACCTTGGTGAACATCGAGACGAATGTCACGTCCGC
GCCGGTCGACGACCCGCAGTTCGTCTCGAATGAACGGAACCACGTGTGGTGGCGCGTGTCGAAGTCGGTCGACTTGCAAAATTCAGCGCCTTGCACGACC
AGAAAGATGTGCGGGAACAGGAACAGAATGCCAGAGTGCATGCCGGTGCCGAGGCCAACGCTAGACAGCACGCCGAGGCCTACCCACCACACAACGTACT
CGACATTCGTGTTGAACTCGTCCAAGTACACGTGGTGTTCGCCCGGTGTGTTGGAGAGGCCGATCCACAGCAACACGAGCGGCAGCGCCAGGAACAGTGT
CAGGGGGTGCGTTGCAAGCGCCACGATCGCCCATCGAACGAAATCCTTGAGCACGATGGAAAAGTGGTACAGCACCGACAGCGGGCGTCGAAATAACGTC
AGTTTCTGTCGCTCGGCACGCAGCGTCTTTTCGAGCTCCGCCACACTGTCGTC