Description :
From Genome Similarity Track
Location :
Scaffold_163:20899- 26344
Sequence
5445 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTGGTCCGTCCAAGGACCACTAAACCCGTTCAACATGAACATGTTGGACGACGAAGGTGACGACACCTTTCAAGGCA
CCCGTGAAAGTTACTCCTATTTGAGTGATGTCGAATGGAGTGCGGTCGAACGAATGAGTTCGACCGTTGGCGAAGAAGCTGTCTGGTCTGTGCTATCCTC
AAGGGATAGGGACCAACAGCATTCCATAACCGCCAAGTTCTTGCAACGAGTACTTGACGCGTCGCAAGCTGAAGTGAACCTGCCGCATCATCGCGGTCAC
CAGCAGACTGAGCTCCTGAGACAGCAACAGTCTCAGTCTGCTACTGCAGCGTCGACACGTGATCGTCGACGCGGGACACTAAAGTTAGAAGTCTCCAAGT
ACCGAGAAGTCGAGGAAGACTCCCTGTTGAGATGGTTCCTCGAATTGGACAATGCTATTAAAGCTCACCACATCGACGATGAGGAAATGCAAGTTGCATT
TGCCAAATCGAACTTGTCAGGGCGTGCCAGAACTTGGGCCCTGAATTTTCAATTACACAATCCAAACGTGTTTGGATCGTTGGCGGTCTTTAAGACTCTG
CTCAGCCAAACGTTCGAGCCGCCAAGAGCTGAGTTCAGGACTCTTTCAGATCTCCTGAAGATAAAACAAGGTCAACGTTCACGCTTACGCTCAGCACGTT
CGTTAACTTGCAAGTTACGTTCACGCTTACGCTCAGCACGTTCGTTAACTTGCAAGTTGCATGGTAGCGAACCCTGTAAGTGAATTCGTGTTGATCACGA
TATTCTTACAGGGCCTTATAGATGGTCCAGCGAGGAACTACCTATTCTGCATCGAGTTGAAGTCGCTTGAGGAAGCGATCCCAACTGCGGTGAAAGAGGA
CTTTAGTGTGAGACATGCCCACACTGTCTTAACCTCCTATCGTCCTTCGAGCCGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTTCAGTGTCGAG
AGCGAGAGACCTCGCTCTTCAAGCAGGAAGCGATTGCAAAAGTGCAATCGCTGTCAGAAGTTAGGACACTACGCCTATGAGTGTAGTGCTTCACGCCCAG
TGTCTCGTAACACTGAGTGAAGTGATCGACCGTCTGCCAAGAAGGGCAACGGACGCGGGTCCGACGCTGTCACGAAGTCACAACAGCGTGGCGGACCATA
AAAAAACGGTCGGGGTCAGTAGGGGCAGAGCGCCCTACTGATCCAGCAACCTCAATAGAATTTGCAAACCTATTGATGAAAGTTGCTCCAGACTCACAAT
CCTAGTGTGTCTCTGCACTTGGTGATGAGGTACCCCTCATCACCTTGAATTTAGAAGCGACAAAAGATTTGTCACTTCGTGTCGTAGTTGACTGTGGGGC
GTCGAACAACTTTGTTCGTCGCCAGTCGCTAGAGGATCGTAGGCTCAAGTTCGTTGAGCGCGTTACTCCTCCTACGAGGCTGACGGTGCGTCTCGCAACA
GGCGCATCGATAGCAGTAATGAAACGTGTAGTGGGATTTCACTACACGTTAGAAGATTTTCAGTACAATGATGATTTCTCGTACTTGATTTGGATGACAA
ATTTGATCTCATCCTAGGGTTACCCTGGCTCAGAAGGTACGAGCCAAGGGTCAGCTGGCAGCATCAAACCGTGAAGATGCCTGCCACTTGTTCATCAGAT
AGCCATCTGATGTACGTCTTGGAGCGTCCACAAGCGTGTGGATTTACTGCGAGTGAGTGCGATGGCCTCACTTGCGGTACGGTCGTTAGTTCGACTGCAC
AAGATCACAGTGTGACAACCAATCACACTGTGGAGGAAGCTGCCGGCGGCTGTGCGGATGCACAGGCAGTGCCGAAGGTCCACCACTTAAACAAGTCGAG
TGGATCGGGACATGGGTGTACGCCTAGCGAGCGACATCTAAGTAATATATAAACCGGTTGCCCACACAGGGCAACACGATGATCCTAGATCGACTGGAGA
GTCGATCGTAGAGGACCTAGCTGAGGTTACGCAACCAAAGCTAGAAGACATCGACGGAATAAGCCCCCCTTCAGCCTGTGGAAAGGGTTTCAGGGAAGAA
ACTGAGACATTGAATGTCTTGGCTAATGACAGGTTAAGTGTAGACGCTTATACACTTGATCTGGTCGCTCCTCCAAAGTTGACTACGGAGATCACTCAAT
TGCCAACGCTAGAACCGAAACGATTCTTGCGAGATCTGCGTAGTGGCAAGGTCAAGAAGATCTGGGTACTCGTCACGGAGGACGAGTACGTGACTGACAT
TCGGTCGGCAAAATTATTTGCCGAGAAATAACGGGTTCTCAGCAGCTCATCGATGGACGAAAGTGTCCTCGATGAGAAGACTCGGAGTGAGCGATACACC
TCTCAATCTTGGGATTCGCTTCAGGCAAATATTTTGTATAAGGATTTTATCGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTGCCTAAGG
ATAAAGGCACTCGACATGAAATCGAGCTCAAACCGGGCTTGAAGTACTGTGTCATGAAGCAGTGGCCACTGCCTCGTGAACAAGTACTTGCGATCGACAA
GTTCTTTGCCGATCGCTTAACTGCGGGTCATGTGAGGGATTTAACTTACCCTCACAGATCTTCGACCTTCTGTGTGCGCAAGGCCAAAGGAGGATGGCGG
ATAGTGCACGCATTCAACAAGTTTAATGCTGCAACGGTACCAGCTCAGACGCCGGTACCGAGGAAGGACGTAATCATTGATGGTATGTCAAAGAGTACCA
TCTTTTCGTCCATGGATCTGATGGATGGCTTCTATCAAATCCTAATGCGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCTAGCGGCATTCTTTG
GGAGTGTCTAGTAATTCCACAAGGGCTTAGTAACGCCCCTGCCACCTTCAACAGATGTGTTGCAAATCTGTTGAGACCAGTGCAAGACTTCACACCGAGT
TACTTCGGCGATGTATTCGTCCATAGCTGGGCTATGGACGGAAAGACGGACGTAGAGGTTCATAGAACACACGTTCGTCAGGTTCTTACACTCATGCGCA
AGCATAAGCTGTACGCCAACCTCAAGAAGTGTATATTCGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGCAAACACGGCATACGCCCTGATCC
AGAACGATCAAGGCGATTACCGACTGGCCTGTGCCATTCGACGTTAAGACTAAGAAATTTCCTTGGTCTAGCGGCGTACTTACACAAGTACTCGCGCAAC
TACGCTGAGATGACCGTTCATCACTCTTGTCTCTTGAAAGAGAAAAATTGTCATGGAACGCTGATTGGCAGCTTTCCTTTGAAGGTATCAAGCAGAGCTT
GATGCAATCGACCATCTTGGCGATTGCAGACCAAGACAGACCATTCCATGTGGTCTGAGACGCCAGCGATTTCGCAACCGCTACGAGTTGATGCAGTACG
ATGCAGACGGCGCAGAGCGCATCGCCTGTTATCAATCGCGTCAGCTGCAAGTAGGTGAGAGTAATTATCCAGTGCATGACAAGGAACGCCTTGCCATGAA
GTATGCACTAGCGAAGTTTCGCATCTATCTCCTTGAATATAGGCCGTTTGTAGTCTATATGGACCACGCGTCATTACGCACGGCTGTAAACAGCCCACAC
CTCTCGCAAAGGATGGCAAGGTGGCTGTCCTTCTTGAGGAGTACAACTTATCCGTTGAGTACAAATTCCGATGACTTAATGTCGTCTCGAACGCGTTGTC
GCGCCGACCCGATTGCGAGTCGGCTGCGCAGTTCAACAGTGTGGTTGATACTACTGTTTCAACACTAGTCACTAGTGTCTCGTCGTCAACATTGCTTGAC
GACATAAAAAAGGCCTACGCAGTAGATAAGGCTCTTCTGCGACTAATGGATCATCTGGTGACTCCATCTCGTTAATCTCTCAAAGATTTTCCGGTCCTGT
AACGATCTTCCGCGGATCGATACACAACACGCAACGGGTTGCTATATTATACAGCCGTTATTGGCGACACACCTCGTGTAGTTGTCCCTAGTCATAATGA
TTTGCTCTTATGCATCATGTATGAGTGCCAGGATTCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCACGGTAAGTCGCGACTTTTACTGT
CCCCGACAGTATAGTTTGTGTGCAAGTACATTCGTGCTTGTGAATTGTGACAACAAGTGAAGCACATTCCTTCATCCCGTGCGCCACTACAGCCTCTACC
AATCCCGGACGAGTGCTGGCACTCCGTTTCATTGGACTTCACCTTCGGTTTCCCCGAAGACGCTCACAAGAATAATGGTATCCTTGTGTTCATAGACCGA
TTCAGCAAGATGGTACATCTTGCTGAATCAGTCAATCTCAGCACATGGTTGTGCCCGTGTCTTCATTGACGCGGTATTCCGACTCCACGGTCTAACCTGT
GAACTAGTCTCTGATAGAGTCCTCGGTTCACGGCTACATTTGGCAATCCGTGTTCCGATACCTCGGAACACGTCTGACTATGTCTACTTCTGACCATCCC
AAGACTGATGATCAGACAGAACGCGTGAACCGCGTCCTCGAAGAGATACTTCAAGGATACGTCCAATCCTTCACAGATAGAGCGAATTTTTGCCGATGGT
GGAGTTTGCAATCAACAATTCCGTGCATGCATCGATAACGCATACACCATTTTTCATGAATGGCTTACACCATCCATGCCTACCCACCTATTTAGAGTGT
GACACTAGTTCAAGGGGGAGGGATTCGCTCGAGCAACAACTGTTCTGGCTCTTGCTCATCATGTATCGAGGTAATCGACGACGCGAACATTGCCGATTTC
GATCAAATTGAAATCGAAGACGATAACCTCATCAGTAGTGACGATAATATTGCTGACCCAGATGAGAGTGACGATGCTGGTATATTCAGCATCGCCAATG
ACTACACCATCGAGGATAAGAACACCCTCGCTGAAGAAGAGAATGACCTTGTAGCGGTGCTCACAAGGCTCACTGCAACAAACCAAAGTGATGCAGTAAA
GGATTTCTCGCTGGCACGAGAAGCAATAGTCCGCTTCGTGCAAGACTCCATCGCTGACGCGGTGGACCGGCAGAAACGAAACGCTGACAAACATGGAAGA
GCAAACGTTCTTCTATTTAATGTCGGAGACTTAGTTCTACTGTCTATGGTAAATTTACCTAAGCGCACAGAAACTAATGTGGGTAATAGTAAAATACTAC
CCAAGTACATCGGCCCGTTCCGCGTACTAAGTTGCAATGGCAATGCGTACACAATCGAGTTGCCTCGCAGGATGCGTACGCATCCTACGTTTTATGTCGT
TCGTCTCCGCCCGTACCATCACCACGAGGTCTTTTCCTCGGGCGA