Description :
From Genome Similarity Track
Location :
Scaffold_182:20890- 22894
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_182-fgenesh-gene-0.10Nucleoredoxin
Pytve_DAOMBR484maker-pve_contig_182-fgenesh-gene-0.1150S ribosomal protein L22

Sequence
2004 bases(100 bases per row)
AAGGTTCAGAGTGGAGAGAAGCAATTTATTGATATGCAAGCCTGCCGAGGCTCCGATTAGCACAGCACACTACCGGGAAAGAGACAACGGCCGCACTCGC
GCTTGCCTTACTGGCCGAGCTGGCCCCAGAGCTTCTCGACGTCGCCCTTGGAGTTGGCGACGAGCGTGCGGCCGTCCAGCGTGATGACCTCGCCCTTGGA
GTTCAGGAAGATGAGCATCGGGATGCCCGTGACCTGGAACTTCTGGCCGAGCGCCTGCTGCTGCGCGCGGTTCTCGAACGGCACGGCCAGGAACGGCATC
TCACCAAAGTACTCCTCGAAGCTCGCCACGTCGCGGTCCGACGAGACGAAGAGCAGCTCGAACTCCGGGTGCTCCTCGATCATGTCCTCGTACACGGCCG
AGAGGAAAGGCGTGAAGCCGCGGCACGGAGGGCACCAGTGCGCGCTGAAGTACAGGCCGACGACCTTCTTGCCGCCGAGCACGTACGACGTGTCCTTGAG
ACCGTCCTTGGTGCGGATCTGCTCGCCCACGAGTGCCGTCCACGTCGCCATTGTTGCCGAGAAAGATAAGTGGTGAATGAAGCTTGTCCGACCCGAGGGA
AAACCAACTGTGGCGGGCCGGAGTGTCGAGATCCTTGACCAGGATAGCTTCGCAGCTAGGAACCTCGAAACTTACCGTTTTTATGACGAAAGAAAAGGAA
GGACACGGGGTAGGGTGTTTACGTGATAGCTCGCGATTACAGTGACGCGCCGGATACGTGGAGGTTACGCAGTACGTCACTGGCCAAAACGGCAGATTTA
CGATGCACCAGGGGTGCGAATTAATGCGAAAATTGGCGGCGATACAGAAAGATTACCCGTAACATTACCGCTGCTGGAAGGACGTCATCTACGGTGTTTG
GGGTCAGCATCATCGCGACATGTTCAATCAAGAATATCACGGATGTGATCTGGAAGACGCCAGACTTCTCTGGAAGCCGCGACACTAGATTCAAGGTGCC
GGCGGCTACATTTTGGAGACTGGCGAACGATTCCACCAGCGGTTCCTTTTGTAACGACCCTCCACGTCAGGTGATGGCTCTTGAGTGGGGCAATGTGCTG
CATAGTACAGCGCGTACCACTGCCCTTGTCAACGCCCGCACAAACCTCGCAGAGTGAGACAGTCTGGTTGTCCAGTATGCTTAATTGGCTACACCACAGA
TCATGACGATACGCTGCAGTGAGGCGATAGAGGCAGCACGGCCGAATGGTATTGCAGGGCTCGCACTCGCGCCGAGTCTATCAAGATGGGTTTCTATGCC
TGCGTCTCGGCCTGGGTCGCAGCCTCCTCGACCGCCGCTGCAGCGGCCGCCTGCTGGCTCTCGCGCGCGAGCTTCTTGGTCATGAAGCGGTTCAACTTCT
TCTTGGACGGGTCGAACTCGCGCAGCACCACGGTCAGGTGCGTGTGGGGGTGGTGCATCACACCCGATCGGCCTGCAACCAACGAACGCGCCACCAGTGA
GCATCATGTACCTGACACCATACACAAGAGTCATACAAGCAGCATCAACGCACCTCGGCCCATGATCTTGAGGCGCTTGAGGTACTGGCCCTTGTTCACA
AAGCACTCGGCCACCTGCAGCTTCTCCGGCTCGATCTGGTACTGGATGTCGGCCAGGTTGATGGCGTTCTGCACCGTCTTCTTGACGATCTCGGCCTTGC
GCTTCGGCGAAAACTTGAGCTGCAGCAGCGCCTCCTGCGCCGGCAGACCGCGGATCTGCTGCGCGATGTACGTCATCTTGCGCGGACTCACGCGGATGTT
CTTCTTCATCGTCTTGACCGTGCGCGCCTCGCTCGGCGCCGCCGCATTCAGGAACGCCACCGTCGCGTCCTCCTCGCTCTCAGCCGTCGCGTCCGTCGTC
GTCGAAAAGCAAAGCCGCGCGGCGCCAGCCTTGGCCGTCTGGCCCGCCGCGGCGGAGCGCAGCGACAGCGCGCTCATGCGAGACGACAGGGCGGTCAGCA
TGGT