Description :
From Genome Similarity Track
Location :
Scaffold_84:2089- 6955
Transcript NameFunction/comments
Hyaar_Emoy2808596hypothetical protein

Sequence
4866 bases(100 bases per row)
TAGGAGTAGATGGCGCAAGCCATTCACGAAGAACGGTGTATGCGTTGTGAACGCATGCACGGAGTTGTTGATGGCAAACTCAACCATCGGCAAAACTTTG
CTCCAATATGTGAAAGATTGGACGTACCCGCGGAGAATTTCTTCGAGGACGCGGTTGAAGCGTTCCATCTGACCATCAGTCTCTTGATGGTCGGAAGTAG
ACATAGTCAGACGTGTTCCGATCGCTCGGAACACGGATTGTCAAAACTTCGCCGTGAACCGTGGAACTCTGTCAGAGACTAGTTCACAGGGTAGACCATG
GAGTCGAAAGATAGTGTCAATAAAGACACGAGCACAACCCTGTGCTGTAATCGACACCTGAAATTCAGCAAGGTGTACCATCTTGCGAATCGATCAATGA
ACACAAGAATACCATCATTATTGTGTGGGTCTTCGGGGAATCCGAAGACAAAATCCATTGAAACGGACTGCCAGCACTCTACCAGGATTGGTAAAGGCTC
TAGTGGCGCTTGGGATGAAGGACTAGGCTTTACCCGTTGACACACTTCGCAAACACGAACGTACTTGCGCACAAACTGATACTGGTGAGACCAATAAAAG
TCGCGGCTTACCGTGAGATAAGTCTTCTCACGCCCACGATGTCCACTAGTTGGTGCATCGTGGCACTCATACATGATGCGTGAGCGCAAATCATTATGAG
TGGGAATGACGACACGAGGTGCGTCGCCGGCAACGGCTGTGTAATACAGAAACCCGTTGCGTGTTGTGTATCGATTAGCGGATGATCGATACAAGGCCGA
TAAATCTCTGAAAGACTAAAGAGATGGATTCACCAGATGATCCATTAGTCGCAGAAAAGCCTTTTCTTCTGCGTAGGCTTTCCTTATGTCGTCAGCCAGT
GTTGACGAAGTAATACTAGCCACTAGTGTTGCAACAGTGGGATCAATCCCACTGTTGGATTGCGCAGCCGACTCGAAATCGGGTCGGCGTGATAACGCAT
CAGCGACGACATTAAGTCGTCCTGGTTTATATTCCACAGAAAAGTTATACGCCGCGATGAAGGACAGCCACCTCTCCATTCTTTGGTAGAGGTGTGGACT
GTTTACAGCCATGCGTAATGACGTACGGTCCGTATAGACTACGAACGGTCTATCTCCTAGGAGATAGATGCGAAACTTAGCCATTGCATACTTCATGGCA
AGTAGTGCCTTGTCATGCACTGAGTAATTACGCTCAGCTGCTTGCATCTGGCGCGACTGATAACCGACGACGCGCTCCGCGCCGTCTACGTCATACTGCA
TTGGCGCGCAGCTGATCGCGAAAAACAAATCACTGGCATTACAGACCACATGGAATGGTCTGTCCTGATTTGCAATCGCCAAGATAGGCGATTGCATCAA
GCTTTGCTGATACCACAAAGGAAAGCTGACAATCAGCGTTCCATGACCATTTCTCGTTCCTTTTCAAGAGACAAGGAAGATGAACGGTCATCTCGGCGTA
GATGCGCGAGTACTTGGCCAAGTATGCCGCTAGTCCAAGGAACCTTCTGATTCCCTTAACATGGACTGGCACAGGCCAGTCGGTGATCGCCTTAATCTTT
TCCGGATCAGGGCGTACACCGTGTTTACCCACGATGCACCCAAGAAGTGGTGTTTCGCTCGCAGCGAATATGCACTTCTTGAGGTTGGCGTACAGCTTAT
GCTTGCGCATAAGTGTAAGAATTTGAACAACGTGCGTTCTTTGAACTTCCACGTCTGTCTTTCCGCCCATAGCACGGCTATGGACGAATACATCATCGAA
GTAACGCGGTGCCAAATCTCGCACCGGTCTCAACAGATTAGTAACGCATCTGTTAAAAGTAGCAGCGGAATTGATTAGCCCTTGTGGTATTACTAACTAA
TCCCAGAGCATACCGCTTGGGGTTCTCACCGCAGTAAATGGGATGCCCCTTTCGCTCATCACGATCTAATAGAAGCCATCCATCAGTTCCATTGATAAAA
AGATGGTACTCTTTGCCATACTATCTATGATGACATCTTTTCTCGGTGTAGGCGTCTGAGCCGGTACCGTCGCAGCATTCAACTTGTTGAATGAATGCAT
TATCCGCCATCCTCCTATGGATTTTTGCACAGAGAAGGTCGTAGAGCTTTGTGGGGAGGTTGACACCCTCACATGGCCCGCTGCTAAGCGATCTGCTAAG
AAGTTGCCTATCGCTAGTACTTGTTCACGAGGCAGTGGTCACTACTTCATGACACAGTACTTCAAGCCCGGTTTAAGCTCGGTTTCATGTCGATTGCCTT
TGTCCTTAGGCAACTCGCATGGTACGGATTCAGAGAACACATCCTTGTATTTGATAAAAATTGTATATAAAGGATTTTCCTGAAGCGACTCCCAAGATTA
AAACGTGTGTCGTTCAATCCGATTCTTCTCATCGAGGACACTTTCTTCCATCGATGAGCTACTGAGAACCCGTTCGTTCTCAGCAAAACTACTGCCAACC
GAATGTCGGTCACGTACTCGTCCTCTGCGACGAGTACACAGATCTGCTTGACTTTGCCACTAAGTAGATCTCGCAAGAACCGTTCTGGCGTTGGAAACTG
AGGTATCTCCAAATTCAACTTCGGAGGCGCGATCATATCAAGTGTAAAAGCGCCTAAGCTTGATCCGTCATTAACCAAGACATTCAATGTCTCGGTTTCT
TCCTGAGAACCTATTTCGACAGGCTTCTGGGAACTCATTTCCTCAGGCTGATGATGTATCTTTACCTCACCAATACCTGCTTGAGGAGTTTCTTCTTCAA
GTACGTGGGGACTTATTCCCTCGACGTCTTCTAGCTGTGGTTGCGCTACCACATCCAGGTCCTCTACGGTCGACTTTCCAGTCGACCTAGGATCATCGAA
ATGCCCTGAGTGGGCAACCGGTTTATTCTTCCTTGGATGTCACCCGCTAGGCGTACACCCATGTCCCGATCCACTCGACTTGTTCGAGTGGTGGACCTTC
GGCGCTGCCTGTGCATCCTCACAGCCGCCGGCAGCTTCCTCCAGAGTGTGATTGGTTGTCACACTGCAATCTTGTGCAGTCGTACTAACGACCGTACCAC
AAGTGAGGCCATCACAATCACTAGCAGTACATCCACACGCTTGTGGACGCTCCAAGACGTTCATCAGATGGCAATCTGATGAACAAGTGGCAGGCATTTT
CACGGTTCGATGCTGCCATCTGACCCTTGGCTCGTTAATTCTGCGCCATGGTAACCCTAGGACGACATCAAATTTGTCATCCAAATATAGTACGATGAAA
TCATCATCTACTGCAAATCTTTCAGCGTGTAGTGAAGTCCCAATACACGTTTCATCAATGTTATCGATGCGCCGATTGCTAGGCGCACCACCATCCTCTT
TGGAGGGTTTCGCGCTCAACGAACTTGAGCCTACTACCATTTAGCGACTGGCGACGAACAAAGTTATTTAACGCCCTATAGTCAACTACGGCACGACGTG
ACAAATCTTCAGTCCCTTCCAAATTCTAGATGATGAGGGGTACCTCATCACCAAGTGCATAGGCACACAATGATTTTGAGTCCGGAGAAACGTTCAACAA
GTGATATGCAAATTCTCTTGAGGTTTCTGGATCAGTAGGGCACTCCACCCGTACTGACCGAGAACGGTTTTTACGATCGACTCCTTTGTTGCGATTTCGC
CACATCGTTGGACCTGCTTCTGTTGCCCTTCTTGGCGAACGGTCGATCAGTTCGCTCAGTTTCGAGACACTGGGCGTCGGTCACTACACTCGTAGGAGAA
GTGTCCCTGTTTCTGATAGCGGTTGCACTTCTGCAACCGCTTGTTGTTTGAAGAGAGAGGTATTTCGCTCTCAACATAACCGAGGTCCATAGGTTCTGGA
CCTCCAAATTCTTGACGTCTTGGAGGACGATATAAACCCGAGATAGCATGAGCATGTCTCAAGATAAAGTCTTCCTTTTCCGCAACTGATATCTCGTCTT
CCAGTGTATCCAGTTCCAAGCAGAACAGGTGAGTCTTGACGGGACCATCCTCAAGGCCCTGAATGAACACCGTAATGAACGTGTGTTCATGGACCGGGTT
GGCCTTAATACAACTCGCAAGGAATTCGTATGTGTTGGGCGTAAGCGTGCACACCACGCTTACCTTGTTCAAGTATCAGGAGCTCTGCTCGAGCCCTGAA
CTCAGCCCGCGGCTGTTCAAACGTTTGTCTAAGCAGGGTCTTGAAGACCTCCAACGACCCAAACACTTATATGTCGTGCAACTTGAGACCTAGTGCCCAA
GTTGTGGCACGTCGTGCCAAGTTCAACTGAGCGAATGCGACTTGCATTTGCCCACCAACGATATGACAAGCTCTTATAGACGTCGTCTAACTCGACGAAC
CAACTCAACAGGTAGTCTTCCTCGACTCCTCTGTACTTGACGCGAAATGCTGAAGACTGATCTCCCCGACGTGCGTATGTCGCATCGGGAACGGCAGTTT
GCGCCTGCTGTTGTCTCAACAGTTCAAACTCTTGAGCACCCTGTTCTCCCAACAGCTCTGCCTCTTGATAACCTTGGTGGTAAATAGTTACTTTCTCCCG
TGAATGGTCAAGTTCATGTTGTATGAACTTGGCGACAGCGGCAGGCTGCTTATTTCTGTTCAGTGCGGACAACATGGCACGGACGGCATGTTCGCCAGCG
GTCGAACCCAGTCGTTTGGCCGCACTCCAATCGATGTCACTCAAATAGGAGTAGCATTCACGCGTGGTGTGAAAGTCACCATCATCATCCAATATGTTCA
TGTTCATGTTGGATGCAGGGGTTGTGGTCCTTGGACGGACTACAAAGTGCTACCAGGTGTCACGGG