Description :
From Genome Similarity Track
Location :
Scaffold_1480:2089- 6580
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1480-snap-gene-0.4Ras-specific guanine nucleotide-releasing factor
Pytul_var.sporangiiferummaker-pug3_contig_1480-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
4491 bases(100 bases per row)
AGGAGCGAATCCGAATGCCCAAACCTTCGAAGGCGAGACTTGTCTTCATTTGGCTATGGCTAGTGGTGACACCAATATCATACTCCGGCTTATTGAAGGC
GGCGCAAATCCAAACATCCAAAATCGCTATGGCCAGACTCCTGCAGCCGTTGTGCTTGCGTTACCACGAGGTCAAGTTCAGAAAGAAAAAATGTTGCTGT
GTCTCGAGATTTTGGCTTGCTCTGGATGCCGACTGGATAAGCGTGATATATTTGGGCGTCAAGTTCTCCATCTAGCGGCCAACATGTTCGAGGAGAGAAT
GTTGAGGCTGGTTCGGAAGATGGGTTCTTTGAGCCTCGTTGGAGAGTCTGACACCATCGATATTTTCGGTTGCTATGCAAAGGACTACAATCTCAGTCAC
CAGAACGACAACGAGGTGTCATACTTGATCGACCACAAGCCGCAAGATTCATGGAAAGTGACAGGCGCGGGAAACCAAGAAAGAGCGTTCGCGTCTCGGT
CCTATCGTATCGACGACCTTGTTCATACCATGATCCACGATGTGACTGTGGATTTCGCGGACATCGTGTCGTTCGTGTTGTTTCTAGAGTCTTTCTCGAG
CCTGAATGAAGTCGTCGAGCGTCTTCGGGCTCAAACTATGACAAAGAGCAAAGGTAAGTACCAGTTATGTGCTGCAGAGATGTGCATGAATATGTTGCTC
AAAAGTTTTTTGTGCTTCTTGTAGGTCGAGGTCTTATTAGGCTTTTTGTCATGTTGATGATTTTCAAGCGGCACAGCGTGGCCGAATCTCAATACGTTCG
CGATCGGTTTTATGCTACGATCCAGCAATTCACGGGAGTGGAGAAGGACCAATTGGCAGCACAAGTCGAGGAATATGAAGCCTTATACATCGAGTATTTT
GCACTGCGAGGCACCGAGTCCTGTTTGGAGCAGTACAAAAAAGTGTCGTTGGAGATGGAGGAGTTGTATAACCCATACAGTCGCGACTTCACGGAAGCAT
TTCCGGTCAACTTGCACCGGTAAGTGTCATGCCTTTCTTCCTTTCCTTCCAGCAAAGTACTTACCTGTTGCGTTCCGTAGTCACACAGAGCCTGCTCAGT
GGGCAGAACACTGTACCCTCTTGACCCATGCGCTATTCTCCAGCATCCCAGGTAATTTGTAAATGCTTTCTATTCGTTTTTGACAACGAGTAGTCTAATC
GCTTTTCTTCATTGTCCGTAGTCGAGGATTTCTTTAAAAGTTCCAAGCAGAGCTACAGTTCTCAGTTTTTGTGCGCAAGACGATGGTTTCAGCATGTATG
TTCTATCATGGAAGTGTTGCTTTACACAAGTGAGAAACTAACTTTATCTATGTACTTCTTGTATGTAGCTCTCTGCGTACGTGATTAATGCTGTGCTTCT
GCAAGACTCCTCACGCGAGCGAGCCAAAGTCATTTCGTTTTTCCTTTCGGTAAGCACACTTTTTTTAGCTGAAATCTGTTGGAAACCTGTAGAACTGATC
AGTTTCGCATTGTTTTTCTACCAGGTCGCTGAGTATCTTTTGTCTCTTCAAAATTTCGACACGCTTGCTGCTATTCTGTATGCTCTGCAATCGACTGCTG
TTCAGCGGTTGCGTCGTACAATCGACCACGTAAGTTCGTCAGCTTGGGATGCGTAAATGTGATGAACTTGCCACTTACGAAGCCTGCTTGTGTTACAGCT
GAGCGTGTCGTCAAAAAAAGCGCTCAACGATATGCAGTTGCTCTCTGACAAAGGGTGTCGAGAGATGAACAAGATCATGCGCAAGTCAGCGAGTCCAAGC
ATGCCATACATCGGACTATACCTTCAGGTGACTTGGAAAATCAACTATAGTTGAGTTGTACTGGTAGGGCTTTTTGTCTAATCTTGTTTGATCTTTTTCA
TGTTGAGCAGAGCTTTGTTGGTTTGAATGAATTGCCAGCGTTTGAGAAGCCTGGGATGGTGAACGCAAATCGACTGCGCAAGATGGGAGAACTTGTAATC
GAAGTGCTTCGTCGCCGATCAGTCCCATACCTGCTGTCATTCAACGAGAATATTGATGTACGTAGCTCTGCATTTTTTTTTCACGTTGAATGTCGTTCGT
CGTGATCCCCTCTAACGCGTTCTTTGTCATTTACAGAAATTGCTGCACGTATCTCTCTTGTACGATACTGAAGAAAGTCGGTATGCTCGCTCGCTAGCAC
TGGAGCCCCGCGAAGCCGATGCTGCTCCGCTGGGTGATCGATCGTCATGGGTCACATCAGAAGACCTTGACATCGAAAACGAGGTGCGTGAGTCCATCGG
TGCGGAAGGAACATTCGGTATTCGTCAATGGCTGCGAAAGCAAAAAGTAGTGCATCGGAACCGTTCAAAATCCTCGGCTCAAGTGGCACAGTATGAATGG
GTTTAAGTAAATCTCCAACAATTTTGTGTTGCAAAGCACGCCAGCGGTGAGTAAAAAGATCTGCCTGCTTTACGTGGCATACTTTGCGTATAGCGTCACG
AGTCTTCAGCGACTTCTTTTTTTCTTTCTTCGGAGTCAATCGCATATGAGGTGCGAAAATGTGTGCGCTTTTCGAAAATAGATAGTTTATTCCAACCGGT
TTTCTTTGATTTACATGTTGCGACCGACTGTGAGCACGCCGTTCTTGAATTTTCCCTTTGTGACCTGCAGCCCGTAGTCGATTTTCTTCTTCTTCTTGCT
GCTGCTGGCGCTGCTGCTAGCCTTGCGCTTGCCCGACACCACATCGGCTTGCTTGTTCTAAGGATTATGTGCAGCAATGCCGCATTGTCAGTGGCACAAT
AAACCCATCCGTAAGCATATAAACAAGCACACCATTACCAATTCCTTGTCGCGCTTTTCACGCTCCACAGCTTTCTTCTTGATGCCCATGAGGATGTGGT
ACGGCGTGTGGCGGTTGCTCGCGGCTTTTCCGCCGAGGGCCTCGATCCTCTTGGTCTCGTACGCCTTCTTTTCCTTCCCTTTCAAACTCGCGTTGGCTGC
AGCATGGCAAACGTTGGTGAGCGAACAGAGCATGCGAGTGAGTAAAGCAGTAAGGTGGCAATATGCAGTTTGTGCCAAGCGTACCGAAGTCTTTCACCGA
GTCGAACGCCTCATCGAATTCTTTCTTGATCTGCTGCTTTAGCGACAGCTCAGGCTCATCCTCATCAGCCTTGCGCTACATAATACAACGGAAAAGCAAA
CAGACAACACTGCGTCATGAGAAGACTAGAACAAACGTTGCGTTTGTGCAGAAGAGAGGACTAGAGAGACACAAACGCTGCCTCGCGTGCGGCATCGCAG
TGAGAGAGAGCGCTCACCTTTTGCGTTCGTGGGGCGCGCTGCTTCCACGACTCAGTGGGGCACTCGAACACCTGCACCGCCTTCTTGGCGCCCGTCGCGA
TCGGGAACTGGAACGACGCCATTTAGCTCTGTGTTCTGCTGTCGTACAGCATTGAATGGTGTTTCGGCCGCTGCTGGCTTATTCGCACGTTTTGGATGGC
TGGCTTCAATTCTGCCAATCATATGTCATGACGGTAATTTTTAGCCAATCTGCATTTTAGATATATGTTGTGTCTACCACATAAGTGAACAAATCTGCGA
CGTGTGATTGCTCTTGGAATTCGAAAGCCAACACGATCAGAGCTCCATGGCCAGCATGAAGTTATTGCATCCGTAATCATAAGCAGAGCTCCAAGATCTA
CGCGCATAAAGCTGGTCAGGAGATCCAGCCGAGCTCGATTCTGCGTCCATAAAGATTCGTCGAAGGTATCCAGGCGACAGACAAAACTGACTCGTCGTTC
AAAAGGACGACCAATCGATTCGGTTGTTTTGACTGGCGCTGTTCGTGTCATCGCGTCGCAAATTGGAGAGGACACTTGCCTATGAGCATTTGGATGCGCA
TGCAGGGCTATGAGTACCGATGGGTACATTTTTACATCACAGAAGTCCACACGTTTCAGGCAGGGGCAAGTGAAAAGTGGGAAATGGCTCCTACATGCAC
CATCCTCCTTTTGATGCGTCGAGCGAATGTCCCACCGTATTCCGACAATTATTGTCTACTTGTTAAAAAAATGGATACTTTCACTCAATCAAAATGTATA
CTCGGTTCCTAGAGCTATTTGCCAATACCAGCATAAATTGAAAGAAGAGTCACCTTTATTATACTAACATCTGTTTAAAGTGCCCACATATGGCGCTATC
TTCTTTCCTCTTAAACAAATTTCCGTCCACAGGGTCAGTTTTTCGAGGGAAAGGGGGCGAAGGGCCCTAGATTTTCTACGTTTTGTTCGGGTAGTTTTTT
CCAGCTCCACTTGGCATTTTGCAATTTGCCGCCAAGCCCGCAACAGAACCCCGCAGCACATAGAGACGCCGACGATGTACTCGCGCATCCGCCCGAACCA
GAGCCACCGCGCGTCCGTCAAGGGCCACCGCAACGTCCACCTCAAGCAGCAGGAGAATTCGCGACCGAGCACCGTGGTCGGCGTGTCGAAG