Description :
From Genome Similarity Track
Location :
Scaffold_772:2089- 5605
Sequence
3516 bases(100 bases per row)
TCAGCATTCAGTACGTTGCTCTCACAACGACTACAACTTAGCGGAGTTCGCGCCGTTTCACTATCACATACCGAGTTTTTTCTCTATACTCATGTCTTTG
ACATCGTCAGAATCAACTAACTCTGACATTCCGACGTCCAGCACACTGACATTTTCAGCCAGTGGCTCGCGCCAATAACGCTTCTGATTCCTAGCAGAGG
TGAGCTCAAATCTCTCCAAAGCTCCGCTAGGGGCAGTGCGCGTGGCCCCTAATGTTTTCGACCTCCAGTCGATCCATGACTCATGGCGCTCGAGCCAAGC
CATACCAAGAATGAGATCATATCTCGAGTCCAAATCAAGTACTAAATAGCGTTCAATACTATCAAGCTCGAAATATTTCACACCTAAGTTCACAGGAACT
TTGGGTGCAGTGACTAGAGTTCCTGTCGCCAAGCAAACAGTGATCATATCACCCTTGTGCGCTTCTAGCGCCTCGACATATCGTGGATTCCCTTCAAGGG
AACAGCGTCTGACATAATTACCGGATGCTCCAGAGTCGATCAAAATCGACCAGTTTGTTTAAGCCCTTAACAGTCGCCTTTGCGACCAACAAGCCTGGCT
TGTATTCACGCCCCGTGTTAGAGTGCACGGGACTCCTTGGGGATAAATTCTGCTCGCCACTACCTCCTAGAGGCTCAACAGAACCTAGTTCCTCCTTATA
AGGGAGCTTCGCGCCTACTGGGAGTCTACATTTTCCCGCACCGTACCAAACTTCTGGTTAGCGGCGGGAGTTTGGCCTGAAGTAGCCTTACGTGCCCTAC
GTAAAGGGCAATTAGGTCGCAGATGCTTTGTGCTTCAGAATGTGAAACGTCGTCGAAATTTTCGATACTGTTCTATAGCTCGAAGCTCTGCTTTTTCGTC
CATCTTGGCGAGACTGAGGTCCATAGGCTCCGGCCTCTTGTATGAACTAAATGAGTTCGCCGAGTTTGGGCTGTACCCATGGGTGCCAAAACGGACAGCC
TTAAAGCTGAACTCAGCGTTCAACGCGATATCCACAGCCACCTCAAAAGAGGTGGGGTGTACCCGGAATACTTCCGTTTGAGCCACGCCCGTGCGAAGGC
CCTCCATGAAGATGGTAACCAAAACCATTTCTGGTAAGGGATCAAGCTGCATGGCAGCGATTAGAGCTCTCAGTTCTGGACATAGTCCGCTAGTTCTTTC
TTGCCCTGACGGACAGATAAGAAACGAGAACGCACTCGGTATGCCTGATTAAGCGGAGCAAACACTCGGGATATTTGCTGTTTTAGCAAATCCCGTGTGG
GAAAATCTTCGTCTACCAACGTGCTACACGTGAGAGCCCATTCTCTGACTCGACGACCTACTTTCGAGATAGCCATCCCAACTCGTGTTGCTCCGACCGG
GGCATAGCGGAGTTCATAGCCATTTCCACCTCTCTGATCCGCAGGAGGAGATTCTCCCCTTCTTTTCCCTCAAATGTCCTTACAGTCAAGACAAGGGGGC
GAGCCCTTGGCTCTTCATCGGGTACGGGGACGCACCTAGTAGGCATAGCCGATGCCAAATGGTCGTGTACTTGCTCAATCAAAGTGGACTCAAACTGCAT
AAACGCGTCAAGACGTGCATGAATCACGTCAGGACCTTGTGCGAGGATTAGATTCACTTGTACGTTCCCGACTAGCGCTCTGAGTTTCTCCAGCACTAAT
CCTTGGGCCTCAGGGAGGGTTAACTTTGTTTTATCCTTATAGAGGAACAGTCTTGAATAGACTCAGGTGTAGATTGACTACGAGTGCTACCAAGTGTAGC
GGAGCTACCCTAACTCCTTGGTCAGAGGAAGACTTCTAGACTCGTAGAGTCTCTTAATATTTTTAAACTAAGCGGATATTAACTTAAAGGGTCTCAAGTG
TTTCAGACTTGGTGAGTCTTAACTGTAAGTGTATGTACAGGCTCTTAAGCTTAAAGTCCTGGTTCAGGGGACTACGACTCCAAGGAGTCACGTGGCACTA
ATGCTCAAGAGTACTTAGCCTTAACTCAGGCACTTAACTCTTACTACCAGAGACGTCTTAGAAAGACACGTGTCTGAAACTGATCGAGAGGGGAGCTGAA
TATATTTACTGATTTATAGCGATAATAAACCTTACTTACGAGTTTAACCTTAAAACTATGCTACCTAATCGAATAGTCCTCATCGTAGTTCTTCTTGTGT
ACCACACCAGAACTACGTCGCCTCTATGAAGGCCCTATTACGATAGATATCCTCTAACCATAACCGATAGGGTGCGGTATTATCGCTTAGCGTTATGTGA
TACAAAAGTATGCCTTATCAGACACTGATCTCTTTCTGTGTGTACCACACCAATGTACCTGGTTATCACAACCGTTTGTGTAACCCCGCTACACCCTCCT
CTACCAAACAGTCGATACCCCGAATCGACATTCTTCACCTTTCTCATTGAGATAGCTCGGAGAGAACAGATAACTTCACGGTTGTGTTCACGACAACTTG
CGCATCAATGGAGAAGTTTTCGCATTCCTCCTAGTCTTTGGAAGGCATCATACGAGAAGAGAAAATCGTTGATTATGACAGTGACAATGTCGCGAAAGAG
GGTGAAACCCCCGAACCTGCCACGTCAGTGTCGTGCGAGCCTTCTCGCATAGCGCCCAACCCATTCCCGGAACGAAGCACGGCTCAAACGCTAACAGAGT
TGCGTGCCTCAACCACTCTTGATGAGCCTATCGTCACCAACGAGCTCGATGAGCAACAGCAACGCTATTTCGAGGAAAATGAGAGAGCTAGACGTCTGTC
TCAGACACTAGCTATTGCCGAGGCGCATTCGGACTATCGCTTCAAGCCTTTGAGCACTGATAAATAGTTGCGAAAGTTCGAAGGGTAGCCCTTGACTACT
TGTCCCACAGGACGCGAGGCTACAACGCTCGACGACAATTCCGAGCGAGATGCTCTCAGAGAGAGATACCTGACACGCGAAGCGACGACGATCTATGAGT
GTCATCTTAAATTAACGGAACAAGCACGTGGTGCCTCTGTACCAATACAGTGAACGATCCCGGTCGTTTTGTACCCCAGCGAGAGTGAGGCAGAAGATGA
TAATACGTTCACTCGCTGGGTTCATAGGGCACGCCGCTTGCCCAGCATGAATGCCCTTAGATCTAGTGTCTCCAAGGCCGACGTTCGGTTAGAGCGCAAA
CTGCGCTATGAATTTGCTAAGCTGAAGGCCAAAGGCCAGCTACGTTCTCTGTATCACAACCAGTATTCAAAACCAGTTGATGGTCAAGCTACAGCCGCGG
GTCAATCGGTATTGACGAGCGAGCCGTACACCCCCACACCTATTGGTGGGAATCACGTTGGGGTGCAAGCTGACCCTCATCGCGACACTCAAAAAAATCG
AAGGCGTACGGGAAACCTTGTCGAAGGGGTACCTCAAACTCCCATGAGTTCTCAGAATCAGGGTATACACGCCACTTCACCAGATACTGGTATTGACCTT
TGTGACAAAGCCGCTT